Busch Lab

ZMP

fem1b

Ensembl ID:
ENSDARG00000062636
ZFIN ID:
ZDB-GENE-071009-3
Human Orthologue:
FEM1B
Human Description:
fem-1 homolog b (C. elegans) [Source:HGNC Symbol;Acc:3649]
Mouse Orthologue:
Fem1b
Mouse Description:
feminization 1 homolog b (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1335087]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa15582 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15582
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090803 Nonsense 86 638 1 2
Genomic Location (Zv9):
Chromosome 25 (position 1376510)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1255796
GRCz11 25 1336441
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGACAAGGTGGTGCGGCTGCTGCTGGATCACTATAAGGTGGACACGGAA[C/T]AAACCGGGACTGTCAGATTTGACGGGTGAGCACTAAAGTGTGTGTCTGTT
Associated Phenotype:
Not determined