Busch Lab

ZMP

si:dkey-26i13.8

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18615 Nonsense Available for shipment Available now
sa39563 Nonsense Mutation detected in F1 DNA Not yet available
sa15225 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18615
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090721 Nonsense 417 991 12 21
ENSDART00000138355 None None 126 None 6
ENSDART00000147623 Nonsense 417 911 13 22
Genomic Location (Zv9):
Chromosome 1 (position 10905550)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11037627
GRCz11 1 11724427
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGGCTGTTWCAGCTGAAGTGCAACAGTACAGTCATGGTGAGATGGCTT[T/A]ACTGCAGGAGCAGCTCCTGTCTGCCTTCAGGGAGCAGATGGAGATCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39563
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090721 Nonsense 929 991 20 21
ENSDART00000138355 None None 126 None 6
ENSDART00000147623 Nonsense 849 911 21 22
Genomic Location (Zv9):
Chromosome 1 (position 10913915)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11045992
GRCz11 1 11732792
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGGGAACACCACCCAGCACCATCCATCAAAAACACTCAGACACCAAA[C/T]GAGCGCAGGCCGTCTACAAACGACAGCGAGGTGAGCTTTTCTTATTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15225
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090721 Nonsense 936 991 20 21
ENSDART00000138355 None None 126 None 6
ENSDART00000147623 Nonsense 856 911 21 22
Genomic Location (Zv9):
Chromosome 1 (position 10913936)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11046013
GRCz11 1 11732813
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAWCCATCAAAAACACTCAGAYACCAAACGAGYGCAGGCCGTCTACAAA[C/T]GACAGCGAGGTGAGCTTTTCTTMTTATTATTATCATCAGTCTTTTTTAAA
Associated Phenotype:
Not determined