Busch Lab

ZMP

si:dkeyp-7c9.1

Ensembl ID:
ENSDARG00000062579
ZFIN ID:
ZDB-GENE-070705-262
Description:
kremen protein 1 [Source:RefSeq peptide;Acc:NP_001108389]
Human Orthologue:
KREMEN1
Human Description:
kringle containing transmembrane protein 1 [Source:HGNC Symbol;Acc:17550]
Mouse Orthologue:
Kremen1
Mouse Description:
kringle containing transmembrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1933988]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33555 Essential Splice Site Available for shipment Available now
sa1168 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26425
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090684 Nonsense 145 440 4 9
ENSDART00000141698 Nonsense 145 289 4 6

The following transcripts of ENSDARG00000062579 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 17945186)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15663710
GRCz11 5 16164271
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGGGATGGAATCAGGCTATGCTTGCTTCTGCGGCGATGACCGTGAATA[T/A]CACCGTCACGGTGATGCTCCGAACACAGAGTGTAACCATGTGTGTTTTGG
Long Flanking Sequence:
CATAAATATATACAGGGTATATGTTACACTGAAGGGCAATGGAACATTATCTTAACTGATATTTTAATGTCATAATTTACCAAAATATTTTACTTGCACTTATTATGCTTTCTATGTATATGAAATCTCTTTTGTAAATGTGATTCAATTGACCTTGAGCCTGATATTTGTGCTGATTAAAATGCATAAGAAGGACCTCTTGGAATTGTGTTTTTTCCCCTGACTTGTTCAATTTATTTATTTATTTTTCAGTTAATAAAATGACTCAGCTAAAAACACACAAAAAAAATCAATATTTGTTCTAGATGTAATCATGTGCATCAACTTGCGTAGGAAGAAATCAATAACACATATTGTATTTTGCGTCCCTTTCTGATTGCCCTCACCCCAGAATTGTCCTGGCATGAAGACGAATTATGAGTTTCTGATTCGTATGTGTTTTTCCAGCTTGCCGGGATGGAATCAGGCTATGCTTGCTTCTGCGGCGATGACCGTGAATA[T/A]CACCGTCACGGTGATGCTCCGAACACAGAGTGTAACCATGTGTGTTTTGGAGATCACACTCAGCCGTGTGGAGGAGATGGACGCATCATCGTCTTTGACAGTACGTTTTCAAACCGTCATGACCTGTGCAGGGGACACAAAGCACAAAGTGCCCCTATTATGCTGTTTTAAAAATTCCAGTAACACTTTACTTGAAAGGTTGTTCATAAAGGTGTAATAAAACCTTTATAATCAATGGACAAAAACAGGTTGTGATGTATTTGTTTATGCCAAGTTGTCATAACAATGTCAACTTTGCATTTGAATGTCTTAACTGAGTAAATGACAGTTGTTATAAGCGTGCATAAAATCTCATCCACATGTGTCATGTCATGATTATAAAGGCTTCATGAAAGTCTTTCGAACACTCCCTTCAAGTAAAGTGTTACCAATGTTTCTGATTGTGTTTTGAGGGTCTCCTATAATAACCTTAAACCACTCCTGAGTCACTAAACTTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33555
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090684 Essential Splice Site 179 440 4 9
ENSDART00000141698 Essential Splice Site 179 289 4 6

The following transcripts of ENSDARG00000062579 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 17945084)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15663608
GRCz11 5 16164169
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCACACTCAGCCGTGTGGAGGAGATGGACGCATCATCGTCTTTGACAG[T/C]ACGTTTTCAAACCGTCATGACCTGTGCAGGGGACACAAAGCACAAAGTGC
Long Flanking Sequence:
TTATGCTTTCTATGTATATGAAATCTCTTTTGTAAATGTGATTCAATTGACCTTGAGCCTGATATTTGTGCTGATTAAAATGCATAAGAAGGACCTCTTGGAATTGTGTTTTTTCCCCTGACTTGTTCAATTTATTTATTTATTTTTCAGTTAATAAAATGACTCAGCTAAAAACACACAAAAAAAATCAATATTTGTTCTAGATGTAATCATGTGCATCAACTTGCGTAGGAAGAAATCAATAACACATATTGTATTTTGCGTCCCTTTCTGATTGCCCTCACCCCAGAATTGTCCTGGCATGAAGACGAATTATGAGTTTCTGATTCGTATGTGTTTTTCCAGCTTGCCGGGATGGAATCAGGCTATGCTTGCTTCTGCGGCGATGACCGTGAATATCACCGTCACGGTGATGCTCCGAACACAGAGTGTAACCATGTGTGTTTTGGAGATCACACTCAGCCGTGTGGAGGAGATGGACGCATCATCGTCTTTGACAG[T/C]ACGTTTTCAAACCGTCATGACCTGTGCAGGGGACACAAAGCACAAAGTGCCCCTATTATGCTGTTTTAAAAATTCCAGTAACACTTTACTTGAAAGGTTGTTCATAAAGGTGTAATAAAACCTTTATAATCAATGGACAAAAACAGGTTGTGATGTATTTGTTTATGCCAAGTTGTCATAACAATGTCAACTTTGCATTTGAATGTCTTAACTGAGTAAATGACAGTTGTTATAAGCGTGCATAAAATCTCATCCACATGTGTCATGTCATGATTATAAAGGCTTCATGAAAGTCTTTCGAACACTCCCTTCAAGTAAAGTGTTACCAATGTTTCTGATTGTGTTTTGAGGGTCTCCTATAATAACCTTAAACCACTCCTGAGTCACTAAACTTACATCTTCCCATGAAAATATGAAGGTGCATCACCATCAGTGTCTGAAATGGTTTGATAAAGAGTCCTGTCTATTTACACTCCGCCTTTCCAAGAGCCTGCTCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1168
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090684 Nonsense 247 440 6 9
ENSDART00000141698 Nonsense 247 289 6 6

The following transcripts of ENSDARG00000062579 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 17942059)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15660583
GRCz11 5 16161144
KASP Assay ID:
554-1078.1 (used for ordering genotyping assays)
KASP Sequence:
GTATCGTGGACCAAAAAGACATGGTGGAGCTGTTGGATGGTAAAACCAAC[C/T]AGGTTGTGGCACGATTTGACGGCCGCAATCCTCCACGGGACATCGTGAAT
Long Flanking Sequence:
AACATATTATGCTATTTTTATGCTTTAGAAAAGTTAAAAACTTACATACAGCAAAGTTTTGCTAAATGAGCAAACTATTTTTTTTTAAATGTGGATTGCCTCATACTCACTAAAATGCAATTCCAATTTTTCCATTTATTTTAATTTAATTTTGTTACTTTGTTAAAAACCTAAAGCTCTTCACTCTTCTCCCATAGCAAAAGTAGGTGCTTGTGGAGGAAACTTCACATCACCTTCAGCAGTGATCTACTCTCCCGACTTCCCAGGCAAATACAGGTCTGGCAGTGTCTGCTACTGGACCATTCAGGTACTATTCATCTTTTAATATCCTAAAGGAGAAAGAGCTCACTAGAGCCAAAATACATAATATGTATCTGGCATACTGACAGCTGTCTTCACTCTTCCAGGTTCCAGGTTCTTCTGTTATTCTGTTCAACTTTACTTTCTTCAGTATCGTGGACCAAAAAGACATGGTGGAGCTGTTGGATGGTAAAACCAAC[C/T]AGGTTGTGGCACGATTTGACGGCCGCAATCCTCCACGGGACATCGTGAATATCACCGCAGACTTTGTCATTTTGTATTTTTACTCCGATAGGACAAATGAGGCACTGGGGTTTTCTGTTGTTTATCATGGTGAGAATTTATATGATTTGTATTTAATGACATTTAACTCAGTTTTTACATTTTGGTCATATCACTGCATGCAATGTAATAGAACATTCTCTATCTGCTTAAAATGTTTAAAAGGGGTCAATAAAATTGGAGAAAGAATAATACTTTTAGAATAATGCTTAATAAAACCTAATAGCATTCATAAAGGCATTGACACTGCAAAAAAATGCTTTTCTTACTTACATTTTTTAATTGTTTCTAGTCAAAATATCAAAGCATTTCTAAATTAAGAAGGAAAATAATATTGTCTTATTTAAGAAAGTCAAAGTCAAGTCAAAGTCAGTTTTATAGTCAGTTTAAGCACATGTACAGGACATACAGAGAATCGAAAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2267
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090684 Nonsense 411 440 9 9
ENSDART00000141698 None None 289 None 6

The following transcripts of ENSDARG00000062579 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 17933791)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15652315
GRCz11 5 16152876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAATAAGYGGGTCAGAATCATGCGCACAGAGCACTACATCTGAACCCTG[G/A]ATCATCCTCTACAGACCTTCCACCATCTCTCTGTTCAAGAAGAAGCTCAA
Long Flanking Sequence:
ATGCAAACCGGGGACATTTTCGAAGCCATTAGTCAAAATAGCACTGAAATCTTACTTGTGATTATCTCTGAGTTGAAAAAATGGGAACAATATATTCTGTATGTTTATCACTGCTAATTCAAACAGCTCCAGTCTGTGGCAAAACAACAAAAACCAGTGCCCCCAGAAAACAGAAACATCTAGTCGCCAAAATAATAAAGTGTCCTATAAAGAATCATGATGATTAAATTGACTTGCTTATCTTCCTTGTTGAAGGTTTTATTGCTGTTAAAAGGACACTGATTTGATTTGCTGCTTTATCAGGGCTGTGTTGTCAGATTTATAGTGTCCGTTTTTGCTCTACATATACATCTTCCTGCACATTTTGCATATCATTTGCTCTAAGCATCCATAAACATTTGATATATATCAACCGTCTTTTTATCCCTTCTCAGGTCCCCGTCCATCCCATCAATAAGCGGGTCAGAATCATGCGCACAGAGCACTACATCTGAACCCTG[G/A]ATCATCCTCTACAGACCTTCCACCATCTCTCTGTTCAAGAAGAAGCTCAAAAACCACCACGGAGACCTCAGCCCACTTGTGGGAAACTAACCTCAACGCCTCTGACCTCTACGGCTGCACAAAGGATGTATACACTGTACGCAATGCTGGTCTTCTGCTGCTGGGCTATAAGAAAGACATCCAACCGAAATGACCCGAGCAGGCCTCAGTTGATCGATTGTTGGGTAACTAATGAATAAACTGTGCAAAAAGAGCTTGATTCCACTGGCTGAAGCGCTTACTCTCAATTTGCATCTCAACCAATCACCAATCATGTGACAGGTGCACATATAAACCAAGAGATTTGATTAGCAAAGGAGTTCTGGGATGTTTCCGTAGCCGCATGTCAGAACGAACAATGACCGTTGGCGGAAATAAAATGGATAGTGGCTCAGCCGTTTCTGCAGGTGCTTTCACAGAAGTGATTGACCGATAAGCGTCTGCATGAAAGAAAGCAGGAG
Associated Phenotype:
Not determined