Busch Lab

ZMP

si:dkeyp-7c9.3

Ensembl ID:
ENSDARG00000062573
ZFIN ID:
ZDB-GENE-070705-263
Description:
Novel protein similar to human and mouse zinc and ring finger 3 (ZNRF3) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
ZNRF3
Human Description:
zinc and ring finger 3 [Source:HGNC Symbol;Acc:18126]
Mouse Orthologue:
Znrf3
Mouse Description:
zinc and ring finger 3 Gene [Source:MGI Symbol;Acc:MGI:3039616]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45192 Nonsense Mutation detected in F1 DNA Not yet available
sa9675 Nonsense Available for shipment Available now
sa20370 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45192
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090657 Nonsense 348 751 6 6
Genomic Location (Zv9):
Chromosome 5 (position 17906264)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15624788
GRCz11 5 16125349
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTATTTTCAAGGCTTGACCTTCCCACAACCTGAAGGTCAGCCTAGTAAT[G/T]GACTCCACAAAGGACACAATAGACCCTTCCAGCCAGGACTTCTGTATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9675
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090657 Nonsense 417 751 6 6
Genomic Location (Zv9):
Chromosome 5 (position 17906473)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15624997
GRCz11 5 16125558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGGACTGTCCCGGAAGCGACAGCAGCAGTAGCTCGGGTCAGTGCCACTG[T/A]TCATCAAGCGACTCCATGTTGGATTGTACGGAGGTCAGCAACCAGGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20370
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090657 Nonsense 452 751 6 6
Genomic Location (Zv9):
Chromosome 5 (position 17906578)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15625102
GRCz11 5 16125663
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGAGCTGCTCTACGTTTCGAAGTTCGCTAAGCAGCGATTACGATCCCTA[T/A]GTGTATCGCAGTAAGAGTCCATGTCGGGGGTCAGCTGGGGAGGCTGGGGC
Associated Phenotype:
Not determined