Busch Lab

ZMP

im:6908224

Ensembl ID:
ENSDARG00000062568
ZFIN ID:
ZDB-GENE-050809-12
Human Orthologue:
MRPL2
Human Description:
mitochondrial ribosomal protein L2 [Source:HGNC Symbol;Acc:14056]
Mouse Orthologue:
Mrpl2
Mouse Description:
mitochondrial ribosomal protein L2 Gene [Source:MGI Symbol;Acc:MGI:1351622]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42317 Nonsense Mutation detected in F1 DNA Not yet available
sa42316 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42317
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090644 Nonsense 18 294 1 6
Genomic Location (Zv9):
Chromosome 13 (position 53984740)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 51659327
GRCz11 13 51899830
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTGTGGGTCTGCTGTCGTCTGCTCTGAGGGCTCTGTGTCTGTCGGGCT[C/A]GCGGACGGTCAGTTCTCAGGTCAGTTCTTCATCTTCTCCATAATCGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42316
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090644 Essential Splice Site 224 294 5 6
Genomic Location (Zv9):
Chromosome 13 (position 53981160)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 51655747
GRCz11 13 51896250
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTGAGCGGCACCGCCATCATTCAGCTTCCCTCTAAACACCAGATTCAG[G/A]TGAGATTGAACAGACAAGTTTACATCACGCCCACAGCAAAACTCTTCATC
Associated Phenotype:
Not determined