Busch Lab

ZMP

rc3h1

Ensembl ID:
ENSDARG00000062550
ZFIN ID:
ZDB-GENE-050208-702
Description:
ring finger and CCCH-type zinc finger domains 1 [Source:RefSeq peptide;Acc:NP_001076328]
Human Orthologue:
RC3H1
Human Description:
ring finger and CCCH-type domains 1 [Source:HGNC Symbol;Acc:29434]
Mouse Orthologue:
Rc3h1
Mouse Description:
RING CCCH (C3H) domains 1 Gene [Source:MGI Symbol;Acc:MGI:2685397]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa24123 Nonsense Available for shipment Available now
sa16237 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29747
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090594 Splice Site, Nonsense 77 1078 1 19
ENSDART00000144545 Splice Site, Nonsense 77 1078 2 20
Genomic Location (Zv9):
Chromosome 22 (position 16126021)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15953591
GRCz11 22 15979861
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATCGAGCAACTGCCCGTCAACACTGCGCTGCTGCAGCTCGTCAGTGGA[C/T]AGGTGAGGCCAAAAGACCCTTATTATACTTACGACAGCTCTGATTTACTC
Long Flanking Sequence:
ACAGAATCATCAAAAACGAAAGTAAAACATTGATGTTATTTCTAACATTTGTTGGTTTTTGTTTTTCAGGTTATGTTTTTCACACTATGTGCTGAACGCCCACAATGCCAGGAAATATTTAAGAACCGTTATCTTTGGAAGAGCTTTATCGGTTCCAGTGGAACCTTTAGGACTTACCGCCGTATCGTTTTACGCAAAACGCACATAGACACCAATGCAGCAATAAGAGAAGACCTTGGGGACCGGAGCATCACAGACCGCGCTTCGCTACAATGCCCGTTCAAGCTCCGCAATGGACAGAGTTTCTGTTGTGTCCCATCTGCACGCAAACCTTCGAGGAAAACCACCGCAAACCCATCAGCCTGGGCTGCGGACACACTGTCTGCAAAATGTGCCTGAACAAACTCCACCGCAAAGCCTGTCCGTTCGACCAGACCACCATCAGCACAGACATCGAGCAACTGCCCGTCAACACTGCGCTGCTGCAGCTCGTCAGTGGA[C/T]AGGTGAGGCCAAAAGACCCTTATTATACTTACGACAGCTCTGATTTACTCTTCTTTAATACTTGTTCGCTTTAATGCCGGTCACACCAAACATGAAATTAAGAATTTGCAAGAGTAAATTGCAAACAAAGACAATGCAAATATGCGAATAGTACTGAATTATTATTGTGCAAATGACGGAACATATACAACACACCTGCCGTGAGTGCTCAATCATGTCTACCGCTTAAGTTTGAATAATTAAACTCACGCAAAACATTTGCAAGATGTTTGCAAAAACATTCTATGAGTAAACTAGAACAAGTGTCTGGTGGGAACTCAGTATTAGGGGCAAAGAGAAGTTGTAAATACCTGAGTAACAGAACAATAGCTGCATTTCTGCTACCCTTTAAATTGCGAATTTGCCTTACGCAAAATTGAAGAAACGCCTATGTATCACACTAAACAAATCTCACTTGCTTAAGCTTCTTTTCTTATAATTTGAAAACAATATTTAATGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29748
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090594 Essential Splice Site 323 1078 5 19
ENSDART00000144545 Essential Splice Site 323 1078 6 20
Genomic Location (Zv9):
Chromosome 22 (position 16140263)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15967833
GRCz11 22 15994103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTATGGCGACCAGTCCCACAAGTCCCACATGCAGTCTATTATTGACAAG[G/A]TACAACAGGATGAACAAAAATGGATTTTATGTAGAGCTGTGGCAAAAAAT
Long Flanking Sequence:
ATTAGGAATTTAATAACAAGTACATGTATTTTTAATAATGAAATATTATTAATTCTAAAAAGTAATAATTGATATTAATGACATTATATTAAATTTGTTTTATTTTTGTAATTTTATTAAAAGTAATTTAAATGAAAATATAAATAAAATTAGGCCTGTATAAAATTGCCATTAGCTATTAAACAGTTACAGTAAACACTTACAGTTAAATATATATTGATGTTAACACATATGTTCAACTATAAAATGAAATGTAAACCATTTTGTTTATTAATTTTTTTTGTTCGTTTTAACTTCAGGTGACCAAGCGTGATGAGGACTCCTCCTTGATGCAGCTGAAGGAAGAGTTTCGCACATATGAGGCTCTTCGTAGAGAACACGACTCTCAGATCGTCCAGATCGCAATGGAGGGCGGCCTGCGCATTGCCCCAGACCAGTGGTCTTCTCTCCTGTATGGCGACCAGTCCCACAAGTCCCACATGCAGTCTATTATTGACAAG[G/A]TACAACAGGATGAACAAAAATGGATTTTATGTAGAGCTGTGGCAAAAAATCATTAGATTTTGTGAATTTTTATTTTTATTTTTTTCCAAAATGCATCACTATTCTGCCTCAAATCGATTCTGAGCTTAGTTTTTAACAGCAGATGGTGCTCTGGGCTAGTCTAGAAGTTAGCCATAACTGTTTATATTATTACAACAATTTATATACTGTACAACAAATATGACTGTTTTTACATTACTGTGAGCGGTAGGTTTGGGGTTGGGCTGGGGTAGATTTTAATAAAATATAATTAATGGCTAAGTTCATAAATAATATAAGTAATTGTCTTTATAATTACTTTTTGTACATTTACTGTGAGGGGAAGGTTTGTGGTTGGTTACATGAGTAATATAATGGGTAATTTAATAAATATTTTAAATAATTGTCATTAAACTCAAATCTGCTTTCCCACAATGGCTCACACTGAGCCAGAAAAAGACACGCACAGCTCTTTTCATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24123
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090594 Nonsense 660 1078 11 19
ENSDART00000144545 Nonsense 660 1078 12 20
Genomic Location (Zv9):
Chromosome 22 (position 16148390)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15975960
GRCz11 22 16002230
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATACGCCAATCCTAGCGCTCATTATGGATACCCTTCACGCCATGACAAC[C/T]GATGCCACTCACCCTACGCTCATCCCCAAACATTCGCCCCACGTGAAGAG
Long Flanking Sequence:
CTGGGTCTTAAAAAGTATTAAAAGTTGATAAATCAATGTAGAGAAATACTAGCTAATTCAGATAGATTTGTATAATAGATTTGTATTCATGATATGAATAATGTTTTAGTTTTGGATTTGTTCCTTACATTAATGTTAAGTATATACGCTGTAAGTTAAAATCTCTTCAGTGTTTCCAGTTGAAACCTAATGTGGTTATAAGGTCTTAAAATGTATGGAAAGAGTCTTAAAAAAGGTCTTAAAAGGAATTGAAGCTCACTCTCTGATTCCTGTATATACTCTGAATTTGACACTTAGAATTTTGCACTTCTATAACCAAGCACTCTGCTTTTCTCTTTTCAGCTGGTAATCCTTACCCCCACCATCATCGTTACCCCCGTCATCCCGCACCCGATCCAGGAATGTCGCCATATCCGGACTCTTATCCCAACTCCTACGTCTCAAAGCACCAATACGCCAATCCTAGCGCTCATTATGGATACCCTTCACGCCATGACAAC[C/T]GATGCCACTCACCCTACGCTCATCCCCAAACATTCGCCCCACGTGAAGAGCTAGTCCGAAGAAGTCCAGACATCCCTCCCCCGCTACAACCCCAAAACACCAGCACCTCATATCTACCCGAATCTGCTCAGGAGAGATACACCAATGACACCTATAACCATCCCAGCCAGATCAGGAATTATCACAGGGTAAGAACCACTACTTTTAATACAACCCCAAATCAACCGCCGCTTTTGGACACTGTTAATATAGGGCTTCTTTTTTGCACAGTACAGTTTTGACTAGCATTTGTGGATATAACTACGTATTGTGGTACTTGACAGGTTTATAGCTTATAGATGAATGGTGATTCTTGACGCAGAGCCGCCTAATGGATCGGAGATTACGTTTTGAAGATTACGTCCTTGTCCTTTACGCACTGAAATACCTCCAGATTCCTTAAATCTTTTAATGATGTTATGCACTGAAGAGGATTTCAATAATTTTCCCATATTTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16237
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090594 Nonsense 807 1078 13 19
ENSDART00000144545 Nonsense 807 1078 14 20
Genomic Location (Zv9):
Chromosome 22 (position 16151455)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15979025
GRCz11 22 16005295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTACACTGCCTCATATTCACCATGGTTATGTGACACCATCGGTTCTTA[C/A]ATCGGCAGCAAAGACATGAAGTCCAAAGAGGGCATGCACTCCAYGGAMGC
Long Flanking Sequence:
TACAAAAAAAGTTTAATACTGTTTTTATAGAAAGATATAATTAATAATACTGTTTTTAAAATTAAACTTGATTGAAATATTCATAATATTATTTTTATTCATTAATACTTATTAGAATTTTCCTTAAATATGTTTATTTAAGAATTTTATTTCATAAATAAAGAATTTTTTATATATGTTTTTTTTATTAATATAAATTACATAGGGAATTTTCAAACATTTTGTTTAGCATTTAAGATTTTCTATTATTATACATTTGCCATTTTCATTTTCTAATTATTTTTTACAATAGATTGTCTCAATGATTTTTATTTTTATATTTCTAAATGTTGTTTACTCAAAAACAAACAAAAAAAGATCGATTTTGTAGTCTTCCATAATAAGTCGTCATGTCCATATGGTTTACAGTACATTGAGAACTCGCATGGATTTGGACACTTCCGGGAACCGGACTACACTGCCTCATATTCACCATGGTTATGTGACACCATCGGTTCTTA[C/A]ATCGGCAGCAAAGACATGAAGTCCAAAGAGGGCATGCACTCCATGGACGCAGTAAGTTTGCCTGTTTATAGTTAACAGAACTTTACAGAAACTTAGCATTGGCCAGTTTTGCCTCGAGGCAGTAAGAAACCACACGCAACGCCCTGACAAACAACCACAAGTATTACATTTGTGTTCATTGCAAGAGGATTTTGCAGTTTTTCTCCCACACAAAAAGTTTGAGCTGTTTTCAGTGGCTGTTCCATTACAAAAGGTTATCAGTGTTTATTCTGGCTAGTCTGTACTAATCATCCTGTTGACTAACCCAAGGCCATAGGTGTATGTGTGTATATATGTTTGTGTGTGTGTGTGTGTGTGCATTATATGGATGTATCAAAGAAGAGATCTTGACTTTAGTTCATTTCATACTAGGGCTAAATATATTGTTTAGGGCTGTAACGATACACCAAACCCACGATTCGGTTCGTATCACGATTTTTGACCCACGATTCGATTCATAT
Associated Phenotype:
Not determined