Busch Lab

ZMP

si:dkey-117i10.1

Ensembl ID:
ENSDARG00000062537
ZFIN ID:
ZDB-GENE-091204-371
Human Orthologues:
GNG12, GNG2, GNG3, GNG4, GNG7, GNG8
Human Descriptions:
guanine nucleotide binding protein (G protein), gamma 12 [Source:HGNC Symbol;Acc:19663]
guanine nucleotide binding protein (G protein), gamma 2 [Source:HGNC Symbol;Acc:4404]
guanine nucleotide binding protein (G protein), gamma 3 [Source:HGNC Symbol;Acc:4405]
guanine nucleotide binding protein (G protein), gamma 4 [Source:HGNC Symbol;Acc:4407]
guanine nucleotide binding protein (G protein), gamma 7 [Source:HGNC Symbol;Acc:4410]
guanine nucleotide binding protein (G protein), gamma 8 [Source:HGNC Symbol;Acc:19664]
Mouse Orthologues:
Gng12, Gng2, Gng3, Gng4, Gng7, Gng8
Mouse Descriptions:
guanine nucleotide binding protein (G protein), gamma 12 Gene [Source:MGI Symbol;Acc:MGI:1336171]
guanine nucleotide binding protein (G protein), gamma 2 Gene [Source:MGI Symbol;Acc:MGI:102705]
guanine nucleotide binding protein (G protein), gamma 3 Gene [Source:MGI Symbol;Acc:MGI:102704]
guanine nucleotide binding protein (G protein), gamma 4 Gene [Source:MGI Symbol;Acc:MGI:102703]
guanine nucleotide binding protein (G protein), gamma 7 Gene [Source:MGI Symbol;Acc:MGI:95787]
guanine nucleotide binding protein (G protein), gamma 8 Gene [Source:MGI Symbol;Acc:MGI:109163]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa38375 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38375
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090589 Essential Splice Site 74 115 2 3
ENSDART00000143715 Essential Splice Site 29 70 2 3
Genomic Location (Zv9):
Chromosome 3 (position 13244058)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13291438
GRCz11 3 13441550
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGAGCCGTGGAGCAGCTGAGGATGGAGACTGAACTGCAGAGAATCAAG[G/A]TGAGAGAGACTTTCATCACGTCAAGTCATTAGAAACTCTTGCATATACAG
Associated Phenotype:
Not determined