Busch Lab

ZMP

TECPR1 (1 of 2)

Ensembl ID:
ENSDARG00000062515
Description:
tectonin beta-propeller repeat containing 1 [Source:HGNC Symbol;Acc:22214]
Human Orthologue:
TECPR1
Human Description:
tectonin beta-propeller repeat containing 1 [Source:HGNC Symbol;Acc:22214]
Mouse Orthologue:
Tecpr1
Mouse Description:
tectonin beta-propeller repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:1917631]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1272 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1272
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090484 Nonsense 46 880 2 18
Genomic Location (Zv9):
Chromosome 12 (position 18864517)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17672714
GRCz11 12 17794588
KASP Assay ID:
554-1187.1 (used for ordering genotyping assays)
KASP Sequence:
TGTTTCTGTCCTCAGGTGTGGGGTATTGCTTTTGAAGACCGGGCCGTCTA[T/A]TTTCGTCAGGGTGTGACTGCCAGCGAGCTCAGYGGGAAGGCCTGGAAGGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27933
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090484 Essential Splice Site 271 880 4 18
Genomic Location (Zv9):
Chromosome 12 (position 18854351)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17664411
GRCz11 12 17786285
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTGCTGCATCACCTTGTCCCTGACCGTGTGAAATGTGATTGTCTCCTC[A/T]GCCCTGAACTCCTCCATGCAGGCCATGTCTCTCTCCATCACACCTGCTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27932
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090484 Essential Splice Site 319 880 4 18
Genomic Location (Zv9):
Chromosome 12 (position 18854203)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17664263
GRCz11 12 17786137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAGAGAGAAATGGAGAATTTCATGCATTATGAGCAGGCCATTGAACAG[G/A]TAGTGCTCTCGCATCAGTCAGCTCACCTCACCTGATATTTTTGATCAAGT
Associated Phenotype:
Not determined