Busch Lab

ZMP

bcl11b

Ensembl ID:
ENSDARG00000062510
ZFIN ID:
ZDB-GENE-061207-62
Description:
Novel protein similar to vertebrate B-cell CLL/lymphoma 11B (Zinc finger protein) (BCL11B) [Source:U
Human Orthologue:
BCL11B
Human Description:
B-cell CLL/lymphoma 11B (zinc finger protein) [Source:HGNC Symbol;Acc:13222]
Mouse Orthologue:
Bcl11b
Mouse Description:
B-cell leukemia/lymphoma 11B Gene [Source:MGI Symbol;Acc:MGI:1929913]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa2902 Nonsense F2 line generated Not yet available
sa36375 Nonsense Available for shipment Available now
sa6468 Nonsense Mutation detected in F1 DNA Not yet available
sa16831 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2902
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090487 Nonsense 500 662 3 3
ENSDART00000144894 Nonsense 633 795 2 2
Genomic Location (Zv9):
Chromosome 17 (position 18005958)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 18155969
GRCz11 17 18175805
KASP Assay ID:
554-2685.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCATCCCGCCACTTCATCAAAGATCCTTTCCTTGGCTTCACCGACTCC[A/T]GACAATCTCCATTCGCCACCTCCTCGGAACACTCCTCCGAGAACGGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36375
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090487 Nonsense 592 662 3 3
ENSDART00000144894 Nonsense 725 795 2 2
Genomic Location (Zv9):
Chromosome 17 (position 18006236)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 18156247
GRCz11 17 18176083
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAGCAATCTGACAGTGCACAGACGCAGCCACACAGGCGAGAGGCCCTA[C/A]AAGTGTGAGCTTTGTAACTACGCCTGCGCCCAGAGCAGCAAGCTCACCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6468
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090487 Nonsense 597 662 3 3
ENSDART00000144894 Nonsense 730 795 2 2
Genomic Location (Zv9):
Chromosome 17 (position 18006251)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 18156262
GRCz11 17 18176098
KASP Assay ID:
554-4595.1 (used for ordering genotyping assays)
KASP Sequence:
GTGCACAGACGCAGCCACACAGGCGAGAGGCCCTACAAGTGTGAGCTTTG[T/A]AACTACGCCTGCGCCCAGAGCAGCAAGCTCMCCCGCCACATGAAGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16831
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090487 Nonsense 644 662 3 3
ENSDART00000144894 Nonsense 777 795 2 2
Genomic Location (Zv9):
Chromosome 17 (position 18006392)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 18156403
GRCz11 17 18176239
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAATGCCCTTCAGCGTCTACAGCACGCTTGAGAAACACATGAAAAAGTG[G/A]CATGGGGAACATTTGATGACGAATGAGRTCAAAATTGAACAAGCAGAGAG
Associated Phenotype:
Not determined