Busch Lab

ZMP

zgc:171495

Ensembl ID:
ENSDARG00000062489
ZFIN ID:
ZDB-GENE-080204-8
Description:
E3 ubiquitin-protein ligase MARCH8 isoform 1 [Source:RefSeq peptide;Acc:NP_001154907]
Human Orthologue:
MARCH8
Human Description:
membrane-associated ring finger (C3HC4) 8 [Source:HGNC Symbol;Acc:23356]
Mouse Orthologue:
March8
Mouse Description:
membrane-associated ring finger (C3HC4) 8 Gene [Source:MGI Symbol;Acc:MGI:1919029]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28088
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054579 Essential Splice Site 10 172 None 6
ENSDART00000135920 Essential Splice Site 10 160 None 5
ENSDART00000144813 None None 282 None 7

The following transcripts of ENSDARG00000062489 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 17909186)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 17729221
GRCz11 13 17860213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTGAAGGATCACCACCAATGCATTCCTGCTGGAAAATGAAGATTCAGG[T/G]ACGAATGGGGCTGTTTTTTTTTTTTTTTTTTTGCTGTTGTCATTGTGCTC
Associated Phenotype:
Not determined