Busch Lab

ZMP

mlphb

Ensembl ID:
ENSDARG00000062481
ZFIN ID:
ZDB-GENE-070803-2
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JI93]
Human Orthologue:
MLPH
Human Description:
melanophilin [Source:HGNC Symbol;Acc:29643]
Mouse Orthologue:
Mlph
Mouse Description:
melanophilin Gene [Source:MGI Symbol;Acc:MGI:2176380]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa41417 Nonsense Mutation detected in F1 DNA Not yet available
sa14687 Essential Splice Site Available for shipment Available now
sa41418 Nonsense Mutation detected in F1 DNA Not yet available
sa41419 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21486 Nonsense Available for shipment Available now
sa30918 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10656 Nonsense Available for shipment Available now
sa25426 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41417
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Nonsense 65 579 2 13
ENSDART00000139725 None None 135 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 25046075)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24201861
GRCz11 9 24012730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAAGACTAAAATTATGAAAGAGGACAACAAGAGAGAGCTGCTGGAATA[T/A]CAGCCTAAACTCAGTGATTCACTCTGCATTCGCTGTCTCCAACCCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14687
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Essential Splice Site 182 579 4 13
ENSDART00000139725 None None 135 None 4
Genomic Location (Zv9):
Chromosome 9 (position 25049463)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24205249
GRCz11 9 24016118
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCACAGAGCCTCGAGACGATGACACGCACAGCATGCCTGAAGTTCACAG[T/C]GAGTAAAACAAAGTCCCATTCCTTTGTGATAWCAGACAATATTAATGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41418
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Nonsense 286 579 7 13
ENSDART00000139725 None None 135 None 4
Genomic Location (Zv9):
Chromosome 9 (position 25052484)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24208270
GRCz11 9 24019139
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGCAATGAGATTAAGGATATAATGCATATCAGCCAAAAGAGTCTGGAC[A/T]AAGCCTCTCATTTTGGTAAGATCTGCTCTCTGCATTTATTTCCTTTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41419
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Essential Splice Site 291 579 7 13
ENSDART00000139725 None None 135 None 4
Genomic Location (Zv9):
Chromosome 9 (position 25052501)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24208287
GRCz11 9 24019156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATATAATGCATATCAGCCAAAAGAGTCTGGACAAAGCCTCTCATTTTGG[T/G]AAGATCTGCTCTCTGCATTTATTTCCTTTACCAACACTTAAAGAAACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21486
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Nonsense 396 579 9 13
ENSDART00000139725 None None 135 None 4
Genomic Location (Zv9):
Chromosome 9 (position 25053289)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24209075
GRCz11 9 24019944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTCTGAGCCGTTTGGAGCAGAAAATGACTTTGCCAATAATTGGGGGAT[C/A]AGTTGAACAGGTAAGTTAAACAGTTGTGCTGCCTAATATTTCTGTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30918
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Essential Splice Site 399 579 9 13
ENSDART00000139725 None None 135 None 4
Genomic Location (Zv9):
Chromosome 9 (position 25053300)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24209086
GRCz11 9 24019955
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTGGAGCAGAAAATGACTTTGCCAATAATTGGGGGATCAGTTGAACAG[G/A]TAAGTTAAACAGTTGTGCTGCCTAATATTTCTGTAAAAAAAAAAAACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10656
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Nonsense 487 579 11 13
ENSDART00000139725 Nonsense 43 135 2 4
Genomic Location (Zv9):
Chromosome 9 (position 25054356)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24210142
GRCz11 9 24021011
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTTCAATTGTATACTCCAGAAARCAAAGCCGAATGCACACAAATCAT[T/A]AAAAAAGCAGAAGAGGGTGAGTTCCTTTGAGTTTAGTAACACAACTAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25426
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090417 Nonsense 532 579 12 13
ENSDART00000139725 Nonsense 88 135 3 4
Genomic Location (Zv9):
Chromosome 9 (position 25055267)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24211053
GRCz11 9 24021922
KASP Assay ID:
554-7344.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTGTTCATGGTTACTGTTTGCTTTATGTGAAGGTTACAGACATTCAG[A/T]AACGAATCGCTGCTTTGAGTGCAGCAGGGATGACAGTGGAGACATCCCGC
Associated Phenotype:
Not determined