Busch Lab

ZMP

sin3b

Ensembl ID:
ENSDARG00000062472
ZFIN ID:
ZDB-GENE-030131-8264
Description:
paired amphipathic helix protein Sin3b [Source:RefSeq peptide;Acc:NP_001038410]
Human Orthologue:
SIN3B
Human Description:
SIN3 homolog B, transcription regulator (yeast) [Source:HGNC Symbol;Acc:19354]
Mouse Orthologue:
Sin3b
Mouse Description:
transcriptional regulator, SIN3B (yeast) Gene [Source:MGI Symbol;Acc:MGI:107158]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41145 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21225 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41145
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090371 Essential Splice Site 585 1196 11 19
Genomic Location (Zv9):
Chromosome 8 (position 14742545)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14187889
GRCz11 8 14225594
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGGGTTGAAGAGGAGTCCAGCCACTGCAGTTCCTGTTGTACTCAAACG[G/A]TTAACAAATTAATTGTTTTATTCTTTGATTGATTACATGTTTTCATCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21225
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090371 Nonsense 694 1196 13 19
Genomic Location (Zv9):
Chromosome 8 (position 14736833)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14182177
GRCz11 8 14219882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTATGAGGACAAACAGATCCTGGAGGACGCCGCTTCCCTCATCATCTA[C/A]CACGTCAAGCGGCAGCCCACCATCCACAAGGACGACAAGGACCACATCAA
Associated Phenotype:
Not determined