Busch Lab

ZMP

si:dkey-21k24.2

Ensembl ID:
ENSDARG00000062469
ZFIN ID:
ZDB-GENE-061207-54
Description:
si:dkey-21k24.2 [Source:RefSeq peptide;Acc:NP_001137519]
Human Orthologue:
HIPK3
Human Description:
homeodomain interacting protein kinase 3 [Source:HGNC Symbol;Acc:4915]
Mouse Orthologue:
Hipk3
Mouse Description:
homeodomain interacting protein kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1314882]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa14832 Nonsense Mutation detected in F1 DNA Not yet available
sa6801 Nonsense Mutation detected in F1 DNA Not yet available
sa17399 Essential Splice Site Available for shipment Available now
sa17006 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14832
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090330 Nonsense 270 1229 1 15
ENSDART00000147572 Nonsense 270 1229 2 16
ENSDART00000090330 Nonsense 270 1229 1 15
ENSDART00000147572 Nonsense 270 1229 2 16
Genomic Location (Zv9):
Chromosome 25 (position 15650155)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15196699
GRCz11 25 15293099
KASP Assay ID:
554-5061.1 (used for ordering genotyping assays)
KASP Sequence:
GGCACAAATGAGATTGTGGCAGTAAAGATAKTAAAGAACCACCCCTCGTA[T/A]GCCCGCCAGGGTCAAATAGAGGTCAGCATCTTGGCCAGACTRAGTGGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6801
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090330 Nonsense 270 1229 1 15
ENSDART00000147572 Nonsense 270 1229 2 16
ENSDART00000090330 Nonsense 270 1229 1 15
ENSDART00000147572 Nonsense 270 1229 2 16
Genomic Location (Zv9):
Chromosome 25 (position 15650155)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15196699
GRCz11 25 15293099
KASP Assay ID:
554-5061.1 (used for ordering genotyping assays)
KASP Sequence:
GGCACAAATGAGATTGTGGCAGTAAAGATAKTAAAGAACCACCCCTCGTA[T/A]GCCCGCCAGGGTCAAATAGAGGTCAGCATCTTGGCCAGACTRAGTGGGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4304
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090330 Nonsense 341 1229 1 15
ENSDART00000147572 Nonsense 341 1229 2 16
Genomic Location (Zv9):
Chromosome 25 (position 15650366)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15196910
GRCz11 25 15293310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAACAAGTTCAGTCCGTTGCCACTGAAGGTTATTAGGCCTGTKCTGCAA[C/T]AGGTGGCCACTGCACTGAAGAAGCTCAAGAGTTTGGGCCTGATCCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17399
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090330 Essential Splice Site 574 1229 5 15
ENSDART00000147572 Essential Splice Site 574 1229 6 16
Genomic Location (Zv9):
Chromosome 25 (position 15692671)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15239215
GRCz11 25 15335615
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AWCCTTTTGTCACTATGCAGCACCTGATGGATTTCCCCCATTGCAACCAG[T/A]ATGTCCAMACATTTATAGTGACTTTTTYAAARTGTCTTRCGTGTTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17006
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090330 Nonsense 828 1229 11 15
ENSDART00000147572 Nonsense 828 1229 12 16
Genomic Location (Zv9):
Chromosome 25 (position 15698236)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15244780
GRCz11 25 15341180
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACGGACAYGCAGCCCTCAGTGTGTCCATCACCAAAGATGCCGGAAATGT[T/A]GCCGAGTGTGGAGCCGCAAACTAGCTCTCCWGAAAGAGCAGTGCAGGCCC
Associated Phenotype:
Not determined