Busch Lab

ZMP

zgc:136894

Ensembl ID:
ENSDARG00000062429
ZFIN ID:
ZDB-GENE-060616-101
Description:
hypothetical protein LOC723998 [Source:RefSeq peptide;Acc:NP_001038768]
Human Orthologue:
TRIM69
Human Description:
tripartite motif-containing 69 [Source:HGNC Symbol;Acc:17857]
Mouse Orthologue:
Trim69
Mouse Description:
tripartite motif-containing 69 Gene [Source:MGI Symbol;Acc:MGI:1918178]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa36070 Nonsense Mutation detected in F1 DNA Not yet available
sa22785 Essential Splice Site Available for shipment Available now
sa22784 Essential Splice Site Available for shipment Available now
sa1620 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4647
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090234 Nonsense 7 497 1 6
Genomic Location (Zv9):
Chromosome 16 (position 15839484)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14184376
GRCz11 16 14074496
KASP Assay ID:
2260-9391.1 (used for ordering genotyping assays)
KASP Sequence:
AGGAGTCACAAGCAGTCAAACAAGTAGCTGTAATGGAGTCTCGGCTGTCG[A/T]AACAGATCCAGTGCTCCGTGTGTTTGGGAGACTTTACAGATCCAGTAAGC
Long Flanking Sequence:
CCTGAACAGTGGGTGCAGAGAACCTACTTTAAGTGATAGGTTTGCACAGGCGAAAAACAGCAAAAATTCCTTCTGACCCCAAAATAGACATTTTCAGCTGGGTATAATAAATGATCTGACTATTTTGAGCTGAAACTGTCACAATTTGGAGACACCAAAGACTTGTTTTATACCTTGTAAAAAGAGGCATAATAGGAGGCCTTTAAATGCGTCTGAGGCAAGCGACAGGATTTATAGAAGGAAGTTCATCTGTGCCCGGAATCAAATGGCCCCCTTTATTTAGCACACTCTAGCACAAACATGTGCTAGTCAAGTATGGGCAGAGGAAGAGCTTGAAAACACACTCCTGCCCCTGCACATGTGATGGACATGTGTTGTCATTTGTCGCTGCAGCTGTTGGGACAACACCTCATCTCCAAACCCCCATGCCAGTGAGTGTTTGGGACATTTAGGAGTCACAAGCAGTCAAACAAGTAGCTGTAATGGAGTCTCGGCTGTCG[A/T]AACAGATCCAGTGCTCCGTGTGTTTGGGAGACTTTACAGATCCAGTAAGCCTGCTCTGCGACCACACGTTCTGCCGGCAGTGTATCAGCAATCATTCCCAGAGCAGCCGATTGAGACTCTGTCCAGAATGCAGGAGACCCTACACCATGTGGGACCTCCGTTCAAACCGAGTCCTGAGGAATATGGTTAGTGCCGTTAGGGAACACTTGAGCGAGCAACAGGCGCTCCAGGACAAGACTGTAGGAGCTTCTGGAGTGGACGCCATGAGAGTGTTTGAGGAACCGGAGAAGCTGGTGTGTTCAGAACATCATGAGAGACTCAAGCTGTTCTGCGAGACGGATCAGAAACTGGTATGTTTGATCTGTAGGGACGGCGAGAAGCACCAAGGACACATTTTCAAACCTGTGGAGGAGGCAGCGGAGCCAAGAAAGGTCAGTGAGGACTGAAAAACATTACAAACTGACTGAGATACGTTCAGGAGGTTAATGCTACTCAGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36070
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090234 Nonsense 240 497 3 6
Genomic Location (Zv9):
Chromosome 16 (position 15836074)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14180966
GRCz11 16 14071086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGATGAAAAGAAACAGAGCAGAAATAGAAGAGAAGCTGAATGATGGA[C/T]GAGAGAAGGAAGGGATTCTGCACTCAGTCTTGGACACTGATCAGCCAGAT
Long Flanking Sequence:
TTACATGCAATACCTAAAGTGCTCAATATCCTGTTCTGTGTGAATTTTGTTATAGATCTGAGATTGAGAATCGCTGTTTTGAGAATTGCCTGAAATCTGAAATTCTTGTATGTTGTAGAACTTAATGTTGGAGCCTCTGAGTTTCCTGACGAAGGAGAATGACGAACTGCAGGCTCTTGTCAAGAAACAGACTAAAGAGATTTCTAAAACTGAGGTGAAAAATACATGGCACACATAAGAGTGAACAATCATGCAATCCATCTAACGACTCCATAACGTCCCACAGAAGTTCACTACTCTCAATGACTCTTGTTTTCTTGTTTTCTTAGGAAAGGTCCAGGCAGCTCTCTGCACACATCACTGCTCAGTTTGAGGAGATGCATCAGTTCCTTAGAAAAAAGGAGGAAGAAGTGAAGAAAACATTGGAGAAAGAAGAGAAGGATTTGATAGAAAAGATGAAAAGAAACAGAGCAGAAATAGAAGAGAAGCTGAATGATGGA[C/T]GAGAGAAGGAAGGGATTCTGCACTCAGTCTTGGACACTGATCAGCCAGATGGATTTCTGCAGGTTATATTCAAATATTTGTATTCAGCACAATTACAATTTTGGATGCTAAGAACTTTTAGGCCCAGAATGAATCTGTTCTGTTTATTTATTTACTTATGTAAATGTGTGTAAATATATTTATATAGACTAAACTATTTTATAATCAAATGATCAAATTGAAACTTTACCCTGTTAACTGTCCCTTTACTTAAGAATCTTTTGATTTAATTACAATGAAAGAAAAACCAACAATCAAACCTTAAATTTAAAATATCTTATCCAATTTATACTAACACAATTTTGATAATATATAACATAATAATTTATTTAAAAAAATAAAATTTCCCAGCTTTTGGAAGATTTCATTATGCTATGCATAATTAAATCGTTAGTAATTGAATATGTGAATGAATATGATGGTCCCAACACAAAAATAAAAAAGCTACAACTATTGGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22785
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090234 Essential Splice Site 260 497 3 6
Genomic Location (Zv9):
Chromosome 16 (position 15836010)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14180902
GRCz11 16 14071022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTCTGCACTCAGTCTTGGACACTGATCAGCCAGATGGATTTCTGCAGG[T/C]TATATTCAAATATTTGTATTCAGCACAATTACAATTTTGGATGCTAAGAA
Long Flanking Sequence:
TGAGAATCGCTGTTTTGAGAATTGCCTGAAATCTGAAATTCTTGTATGTTGTAGAACTTAATGTTGGAGCCTCTGAGTTTCCTGACGAAGGAGAATGACGAACTGCAGGCTCTTGTCAAGAAACAGACTAAAGAGATTTCTAAAACTGAGGTGAAAAATACATGGCACACATAAGAGTGAACAATCATGCAATCCATCTAACGACTCCATAACGTCCCACAGAAGTTCACTACTCTCAATGACTCTTGTTTTCTTGTTTTCTTAGGAAAGGTCCAGGCAGCTCTCTGCACACATCACTGCTCAGTTTGAGGAGATGCATCAGTTCCTTAGAAAAAAGGAGGAAGAAGTGAAGAAAACATTGGAGAAAGAAGAGAAGGATTTGATAGAAAAGATGAAAAGAAACAGAGCAGAAATAGAAGAGAAGCTGAATGATGGACGAGAGAAGGAAGGGATTCTGCACTCAGTCTTGGACACTGATCAGCCAGATGGATTTCTGCAGG[T/C]TATATTCAAATATTTGTATTCAGCACAATTACAATTTTGGATGCTAAGAACTTTTAGGCCCAGAATGAATCTGTTCTGTTTATTTATTTACTTATGTAAATGTGTGTAAATATATTTATATAGACTAAACTATTTTATAATCAAATGATCAAATTGAAACTTTACCCTGTTAACTGTCCCTTTACTTAAGAATCTTTTGATTTAATTACAATGAAAGAAAAACCAACAATCAAACCTTAAATTTAAAATATCTTATCCAATTTATACTAACACAATTTTGATAATATATAACATAATAATTTATTTAAAAAAATAAAATTTCCCAGCTTTTGGAAGATTTCATTATGCTATGCATAATTAAATCGTTAGTAATTGAATATGTGAATGAATATGATGGTCCCAACACAAAAATAAAAAAGCTACAACTATTGGGTTACAAATGCTTAAAAGATTAGTACAATGGGAAAGCACTCCAAAAAGGTGCACAATGGGTACCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22784
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090234 Essential Splice Site 329 497 5 6
Genomic Location (Zv9):
Chromosome 16 (position 15832920)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14177812
GRCz11 16 14067932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACCTGCAGTTTATTGTTTGGAAGGAGATGCTGGGGTCTGTCAAACCAG[G/A]TAAGAAGATCACTGATCTGTACTGTAGTAGACAACACACACTTTACACTA
Long Flanking Sequence:
AACAAATGCTAACAAAAAATTCAAGGTAAAAAGTAACAAAGGCTGTGATATCTGCTACCAGATCTATTTTCAGTTGTCAGTCACCCATATGAAAATATACATTGGTAATTTATAATAAATACTGTAGTGTTTTTAACCATACTGACACTGACACCGCCAATGGAGATAGAGAGGTTGCACAATCAGTTAACATGTTGCTAGAATTGATTTTTATAAATGAGGGAATGATATATATATTGCATCACTAAAAATGGTTGAGGTCATGTCCAAGTGTTGTGCGATAAGCCTATTTATTGATTGTTGTGACAGGCCTATGCTTGAGGTAAACATCACCCACACTGTAAATTTCCCATCAGTAAATTTAATTCATCTCCTGCATTTCAGGTTCAAATCAACAGTGAAAAGTGTGAATTTAATAGCTAATTCTCTGTTCCTCGGCCTTCATGAGACTCACCTGCAGTTTATTGTTTGGAAGGAGATGCTGGGGTCTGTCAAACCAG[G/A]TAAGAAGATCACTGATCTGTACTGTAGTAGACAACACACACTTTACACTACTAGCCACTTCATTAAGTGCACTAATTGTGTCGGAGAGACACCAAAAAGCTACAAACCGGCTGCTTCCTGTTTAGATTCAGCAGTGTTGTCAGAGATTTGAGAGGGGATTTTTTTATTGTATACAGCTGAAGTCAGAAAGATTAGCCCCCCTGTTTTCCCCAGCTTCTGTTAAACGGAGAGCAGATTTTTTTTTTTACACATTTCTAAACATAATAGTTTTAATAACTCACTTCTAATAACTGATGTGTTTTCTCTTTGCAAGGATGACAATACATAATATTTGACTAGATATTTTCAAGACACTTCTATACAGCTTAAAGTGACATGTAAAGGCTTAACTAGGTTAATTAGGTTAACTAGGCAGGTTAGGGTGATTAGGCAAGTTATTGTATAACGATGGTTTGTTCTGTAGACAGTCGAAAACAATATATACTGTAGCTTAAAGGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1620
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090234 Nonsense 366 497 6 6
Genomic Location (Zv9):
Chromosome 16 (position 15829974)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14174866
GRCz11 16 14064986
KASP Assay ID:
554-1561.1 (used for ordering genotyping assays)
KASP Sequence:
ACGGACGCAGCGTCATCCGCACTTCCAAAAAGGGGATTTTCTTGCGTCAC[A/T]AAGACTACAGACCTCTGGCCAGGACCCACAAGACCTTCCAGACGGGACAG
Long Flanking Sequence:
GTATGAATGAATTAATGAATGTTGATCCTTGCTGGGACAGATTTAAAAATAGAAATTCGACTCCATGATCACCTAAAATTGCTTTCTTAAGGCATTGTTTACCCCAGAATTTAAATTGTGTTATTATTTACTCCTACTCTGCTTGTTCCAGACCTGTTTTGTTGATATTCACAGTATTTTTTGTCCCTACTATGGATATCAGAATTCTATCTTGTTTCGTGTTCAAAAGAAATGATTTAGAACCACTTAAACATGAGGAAATGATGAGGAAACTTACATTTTTGGTTGAACTATCATTTTAACTCATAACATAGTTATTGTGTTGTCTAAAAATAAACGAAGATGCCTGAAGGTTCTTATTCTTACCATTTGCTTTGATTTTTCTTTCAATAGTCCCTGATCGGAATGTGATTCACGACTGTCATGACCCGTACCTGAGGGTCTCGTCTGACGGACGCAGCGTCATCCGCACTTCCAAAAAGGGGATTTTCTTGCGTCAC[A/T]AAGACTACAGACCTCTGGCCAGGACCCACAAGACCTTCCAGACGGGACAGCATTACTGGGAGGTTGACGTTGGAGCAAAGCTAGACTGGAGCGTGGGCTTCGATGGCGGCTGTATAAGCAACCTAAACAAGGACATTGGGCTTCACCTTAAACATGACCAGGGCTACTGCATTAAAGAGTATGAGACGGTGACAGAGATCGACCTGACAGTGAAACCAAGCCGGATAGGCCTGTATCTGGACTGCGATAGGTGTCAAGTGTGCTTTTATAATGCAGAGGACATGACTTTACTGCACACCTCCACATATCCTTCGTCCATCCCTTATTCGCTAAGTCTCTCGCCTGGAGCTTATCTGGCCGGGAAGAACAGTGATCCACTGATGGTGACCTGGAACTGAAAAATGTTACATACTTTATGTAAACTTAAACGATGAAATGCTGCTGTACCTGACTAAGTAGTGTTTGAAATAAATGTTAATGGCTGCTGTGTCTGCTTGCTC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461