Busch Lab

ZMP

zgc:153332

Ensembl ID:
ENSDARG00000062418
ZFIN ID:
ZDB-GENE-060929-608
Description:
tubulin--tyrosine ligase [Source:RefSeq peptide;Acc:NP_001070093]
Human Orthologue:
TTL
Human Description:
tubulin tyrosine ligase [Source:HGNC Symbol;Acc:21586]
Mouse Orthologue:
Ttl
Mouse Description:
tubulin tyrosine ligase Gene [Source:MGI Symbol;Acc:MGI:1916987]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24929 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18309 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28083
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090273 Nonsense 33 307 1 5
ENSDART00000123869 Nonsense 33 404 1 7
ENSDART00000142732 Nonsense 29 400 1 7
Genomic Location (Zv9):
Chromosome 13 (position 15882827)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15797860
GRCz11 13 15928852
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGTATGCTGAGGTCGCCAAGATTCTTACTTCAACTGGAAAATGGAAA[C/T]GACTCAAGAAAGACAACCCTCGCTTTAATTTAATGCTGGGAGAGAGAAAT
Long Flanking Sequence:
TATATAGTCAACCACTATTCTTACGCTCTGCACAGAGCTGGCTTGTTCCCGGACTGTGTTTTATAACATCTGCAGTTCAGAGATATTCACTAGCGGAGAGAACGCTAGCGTAGACTGTTAGCCGCGAGAATTTACTAGACAAAATCCTTCAAGAGTCACACCCTAAATTTCAGTTTCCTCGCATCGGCCACGCGATCGACTGCGGGTTCAGATGGTCCACCCTGTCTGGACGACAGTCGTACTATGTACATACTGTACTTGTTAGAGCAATACAACTAAGAAGCGTCAGGGGAATCATGTATGTCCACTTTCAGTCTACTTTGTTGGGAGACAGATAACGTTAGTCTGCTAGCTGTGTGTGTTCTTCATCATTACGCTGCGCTCTTGTCTGAAGACTGGGAATCATGAATTCACCAATATACACGTTTGTTTTGAGAGATGACACCAGTACTGTGTATGCTGAGGTCGCCAAGATTCTTACTTCAACTGGAAAATGGAAA[C/T]GACTCAAGAAAGACAACCCTCGCTTTAATTTAATGCTGGGAGAGAGAAATCGGCTGCCTTTTGGACGGCTGGGTAAATCATTTCAACAAATGCATTGCTAAATCAAAATTTAACACTGATGTAATTGATTTAAATGTTGTTATTGTAGTGTATAATGAAAGTTAGTAGTCTCAGCAGGTTCTTGCAATGTATCTAAGCTATGATAGTTTTCATTAGACCATGCTATTTAAAAACAAAAAAAAACATAAAAGGTACAAAGTGTTTAATTTATGATTATACTCAATGAAGCAATGGTGTGCTGTGTGTCCTGCAGCAATAACCTGATAACAAAGTTTCAACTCTTTAATGCATCTATGTGGATTTTAAACTTTTAAAGTATGATAATCTTAAACCAGTTTTTGAATAATTTAGTCTCTTTATGTAATGAGATGTCTATTTGATGTTTACTACACAGAAACTATTTAATTTAAAATCAATATTTAATTTGGAACAATTCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24929
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090273 Essential Splice Site 161 307 3 5
ENSDART00000123869 Essential Splice Site 161 404 3 7
ENSDART00000142732 Essential Splice Site 157 400 3 7
Genomic Location (Zv9):
Chromosome 13 (position 15879571)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15794604
GRCz11 13 15925596
KASP Assay ID:
554-7374.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGGAGATGGGACAGTGTGGATAGCCAAATCATCAGCAGGCGCAAAAGG[T/A]AAAAAATCTCTGTTGATCCAAAAGACTGTTAAGATATAAACAAAGTTTTT
Long Flanking Sequence:
TTTTTTGAGAGGTCAGTCTCTGGTCTGCATATGTCGAAGAATTTATATGCACAATTTATGCACGCATACGCTTGGCACAGAAGTATAAATCAGACTTAAGTGGAGCATGAATAAATGACAGAATTTAATTTAATCTCTTTAATGTTTTGTTAAGTGAGGAATGTCTTCAAATTGTACTGGGGTTTCCTCATGTGGTTTATTTTCATCAATTTATAGTTTGTTAACCTTGGGAATAATATTTATCTTGTAATATTTTTGATGTTTAGGATTATCAAGACCAGTCCAGAGTTGAAGGACTCCTGTAACTGGTTTCCTGAGTCCTACATCATATACCCAACCAACCTCAACACCCCGGTGGCCCCGGCCACCAACGGCATCAGCCACATGAAGAGCAACCCAAAGACAGATGAGCGAGAAGTCTTCTTAGCATCTTATAACTCCAGAAAGGAAAGTGGAGATGGGACAGTGTGGATAGCCAAATCATCAGCAGGCGCAAAAGG[T/A]AAAAAATCTCTGTTGATCCAAAAGACTGTTAAGATATAAACAAAGTTTTTAATGGGTATTTTGGGTCATATGGATCATTATTTTCATCACAGCATTTGAAAATGAAAGGCAACTTAAAGCAAATTATCTTCAGCAGACCACAAATAACTTCAAAAATTTGAGACCGTTTCAGAGCAATGTTATGGCCATGTTGATTATTTTTGTATTATTGGGCAGTGGTGTTCAACCATGTTCCAGAGAGACCACCAGCACTGCATGTTTTTGATGTTTCCTTTGTCACAACTATTTTAGGTCTTTTAGTCTCCACTTTCGAGCTGATGATCTGAATCAGGGGTGTTTGGTTAAGGAGACATGGATAATCTGCAGAGCTGGTGGTCCAAGAATGTGGTTGAGAAACACAGTTATAGGAAATACAAAGAGCAAAACAATCTAGATTAACAAAAATTAACAGCTTTTTTTTCTAAATTGGATTAATTTGCATGGATTAGATGTTCATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18309
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090273 Nonsense 248 307 5 5
ENSDART00000123869 Nonsense 248 404 5 7
ENSDART00000142732 Nonsense 244 400 5 7
Genomic Location (Zv9):
Chromosome 13 (position 15878605)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15793638
GRCz11 13 15924630
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACAACAGCTCAGATCTYCAGAATATGACCAGTCATCTGACAAACCACTG[T/A]ATTCAGAAAGAGCATTCGCARAACTATGGCCKAWATGAGGAGGGCAATGA
Long Flanking Sequence:
TTGGATTAATTTGCATGGATTAGATGTTCATAATAAAACACAATTGTGCGCTAACAAAATAAACACTACAAATGTTTATATTATGTGGACTTAAATGTTATTTTATTGAAAAAAATAATCCATCATTTATTAGTATGTTAATGTCCCTATCTATGTTCAGGTGCTGGCATTTTGATTTCTCATGACGCAAACCAGTTGCTGGAGTTCATTGATAATCAAGGCCAAGTGCATGTCATTCAGAAGTATCTGGAGAAACCTCTGCTGCTTGAGCCAGGTCATCGCAAATTCGATATAAGGTAAGATGAGCCTTTAAGATGATGGGAGAGCATACAAATGCAATGTGTCGTCCTAATGCTGGATGTTCTTTTATGCAGAAGTTGGGTGCTTGTGGACCATCAGTACAACATCTACCTGTACCGTGAGGGTGTGCTGAGGACATCGTCTGAGCCCTACAACAGCTCAGATCTCCAGAATATGACCAGTCATCTGACAAACCACTG[T/A]ATTCAGAAAGAGCATTCGCAGAACTATGGCCGATATGAGGAGGGCAATGAAATGTTTTTTGATGAGTTTAAACAGTACCTGCTGAACACACACAATCTGGCTATGGAGACCTCTATTTTACCTCAGATCAAGCATATAATCAGGTGCTCATTTACAAAAAAAAGTTTATTTTCGCCATGAAAAAAGATGGAATTTCATGTTTTTGTGCCTATGAATGGGTTACATTAAAGGTGCACTAAGCAATATTAAAAAAATACTTTTGAATACACTGTTTCACTGGGTCGCAAAACAGAATTATAACAGCACTCAGCATTTATACAGCACTCAGAATTATAACAGCATTATAACAAAATTCGCTTGGTGTACCTTTAATACACATGTAGGAAATGTAGCTTACCTAATGTTTCAAAAGCTAATGAATTGGGGTTTTTTTGTGCTAGAGATTTAATAGTCTACCAGTTCAAAATCATAAAAATCTGTTTATATTTTGCATTTGCTTA
Associated Phenotype:
Not determined