Busch Lab

ZMP

frem1b

Ensembl ID:
ENSDARG00000062402
ZFIN ID:
ZDB-GENE-050208-783
Description:
Fras-related extracellular matrix protein 1b [Source:RefSeq peptide;Acc:NP_001131130]
Human Orthologue:
FREM1
Human Description:
FRAS1 related extracellular matrix 1 [Source:HGNC Symbol;Acc:23399]
Mouse Orthologue:
Frem1
Mouse Description:
Fras1 related extracellular matrix protein 1 Gene [Source:MGI Symbol;Acc:MGI:2670972]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa39367 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37483 Nonsense Mutation detected in F1 DNA Not yet available
sa10747 Nonsense Available for shipment Available now
sa17421 Essential Splice Site Available for shipment Available now
sa43806 Nonsense Mutation detected in F1 DNA Not yet available
sa39368 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39367
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Essential Splice Site 110 2167 2 36
ENSDART00000135604 Essential Splice Site 110 2142 3 36
Genomic Location (Zv9):
Chromosome 22 (position 17343178)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17094936
GRCz11 22 17121206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGGCAGTCCACTTCTTGAGGAAGACACCGTCATGTTGAGAGTCTACAG[G/A]TACAGTCTTTCACGGTCATTGTCATTCATGCAAACACACATTCAAGAGTT
Long Flanking Sequence:
TGTCCAAGCTTCGAGTCTAGTGCAGTTAAATCGAGTTATTCGAGTAGCCAGAGGACAATCTGTGTTCATCACAGCCAACGAACTTCAGTTCCACATGGATCACAAATCCGAGGCCTGTAAAGTAGAAGTGGTGCTTAATGAACCCATCACACAAAGAGTGGGAAAACTCACTCCACAGGTAAAAAAAACAACCCAGGATTGGTACTTTACCACCTTTTGTGAAATTCATTCATTCATTCATTTTCTTTTCGGTTTAGTCCCTTTATTAATATGGGGCCGCCACAGCGGAATGAATTGCCAACTTATCCAACATATGTTTTACACTACAGATGCCCTTGCTGCTGCAACCCATCTCTGAGAAAACCTTTTGTGAAGTAAATTTTTTTTAAATGAACTGTTTTTCAGGTTTTCGACTGCCAGTTCTTTCCAGATGAGGTGAAGTATGTCCACAATGGCAGTCCACTTCTTGAGGAAGACACCGTCATGTTGAGAGTCTACAG[G/A]TACAGTCTTTCACGGTCATTGTCATTCATGCAAACACACATTCAAGAGTTCACACTTAGCTCATGATGGATAAAGCTTGTTTGGCATGCTGTCCCAGGAGAGAGCCCTGAACTTATAAGATCCTCAAGCCCTGGGCTCCCTCCCGTTTGCAGGGCATGAGGGAAGCTCAGGTAGAACTCCCCTTACTTATTTCTGGCTAATGACAGATATAGGATGGCTAAGGAGAGATGTATGCTTGCTAAGAGTTCGGCTATGGTATCAGTTTGGTATGATCAATTAATTTGGGTTGCGTGTTTTTGGACTGTGGGAGGAAACCGGAGAACTCGAGGAAAACCCACTTGAGCACAGGGAGAACCAGCAAACTCCACACAGAAATGTCAACTGGCTTAATAAGGACTTTACCCAGAGACATTTTTGTTGTGAGGCAACAGTGATAATCACTGGGCCACTAGTTACCACTCTGGGTATTTAAAGTGATTTAGGATTCATCTGATCAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37483
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Nonsense 185 2167 3 36
ENSDART00000135604 Nonsense 185 2142 4 36
Genomic Location (Zv9):
Chromosome 22 (position 17346044)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17097802
GRCz11 22 17124072
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCACGCTTCGTCTTCTCAGCTCTGAGATCAGTGTTCCAGCACTGGGT[C/T]AGCTGGTGGTTGAGGAGTCTGGAACAATGGTGGACACTGAGGCTGGACCA
Long Flanking Sequence:
CCACCTGCAACCCAGTTCTGGGAGAATTATTATTTTTATAATTAATAATATATATTAGTTAGTCTTTAGTTTACTCTTTCCTAACTAGCATTTAGTTTAAGCTGCCATCCATTGCCAGCATTTTACACCTCAAATTTAGCCCTCAGATTTACTAACATTGTGTGGTCGTCTTCTTTGTCCAAACCAACAATTTATTTCTGTAACTGCAATTAGCTGCTAAAGCCATTTCCGAGGTCTAATGTGATTTCCATAACATAGGTGGTTCTTTTCAATGCAGGTTTACAGACACCGAGACTTTTGTTGAGTCTATGTTGCTGAAGGTACGTGTGTTTGAGCCTCAGAGAAGCCTTGTAGAGCTTGGAAATGTCCCTCTGGTGGTTCCTGAGTTCTATGGCCTTTCCAATGCCATCAACGCCAGCGTTCTCACCTTTAAAACCCAGCCAGATGTGATCTGCACGCTTCGTCTTCTCAGCTCTGAGATCAGTGTTCCAGCACTGGGT[C/T]AGCTGGTGGTTGAGGAGTCTGGAACAATGGTGGACACTGAGGCTGGACCAAGAAAAGGTATTACAGAGTGCATAATGAAGCTTTTTTTGTCAGATCAATGTCTATGGGGTGCAACTGACAAAGTTTTACAGTTCGGCAAAAGAGCAGCGTTTTTTCGTCAATATTTTTTAACAGTTTTTTTGTCAACGTTATTTTTTTGTCAACATTTTTCTGTAACGTTTTTTTTTTCAGTGTTTTTTTGTCAGTTTTTTTTTGGTCCGATTTTTTTTTTTTTTTTTTTTTTTTTGTCAATGTTTTTCTGTCAGCTTTTTTTTTTTTCTTCAACTTTTTTGTCAATGATTTTCTGTCAATGACTTTTTTGGTTAACGTTTTTTTGTCAACGTTTTTTTGTCCAATATTTTTGTCAATGTTTCTTAAAAGTGTCTGATAATTTGACCTTGATGTTGATTTTTTTCTAATATTTCCCAAAAAGATGTTTAACAGAGCAAGGAAATTTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10747
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 None None 2167 None 36
ENSDART00000135604 Nonsense 211 2142 4 36
Genomic Location (Zv9):
Chromosome 22 (position 17346122)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17097880
GRCz11 22 17124150
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGTGGACACTGAGGCTGGACCAAGAAAAGGTATTACAGAGTGCATAATR[A/T]AGCTTTTTTTGTCAGATCAATGTCTATGGGGTGCAACTGACAAAGTTTTA
Long Flanking Sequence:
TCCTAACTAGCATTTAGTTTAAGCTGCCATCCATTGCCAGCATTTTACACCTCAAATTTAGCCCTCAGATTTACTAACATTGTGTGGTCGTCTTCTTTGTCCAAACCAACAATTTATTTCTGTAACTGCAATTAGCTGCTAAAGCCATTTCCGAGGTCTAATGTGATTTCCATAACATAGGTGGTTCTTTTCAATGCAGGTTTACAGACACCGAGACTTTTGTTGAGTCTATGTTGCTGAAGGTACGTGTGTTTGAGCCTCAGAGAAGCCTTGTAGAGCTTGGAAATGTCCCTCTGGTGGTTCCTGAGTTCTATGGCCTTTCCAATGCCATCAACGCCAGCGTTCTCACCTTTAAAACCCAGCCAGATGTGATCTGCACGCTTCGTCTTCTCAGCTCTGAGATCAGTGTTCCAGCACTGGGTCAGCTGGTGGTTGAGGAGTCTGGAACAATGGTGGACACTGAGGCTGGACCAAGAAAAGGTATTACAGAGTGCATAATG[A/T]AGCTTTTTTTGTCAGATCAATGTCTATGGGGTGCAACTGACAAAGTTTTACAGTTCGGCAAAAGAGCAGCGTTTTTTCGTCAATATTTTTTAACAGTTTTTTTGTCAACGTTATTTTTTTGTCAACATTTTTCTGTAACGTTTTTTTTTTCAGTGTTTTTTTGTCAGTTTTTTTTTGGTCCGATTTTTTTTTTTTTTTTTTTTTTTTTGTCAATGTTTTTCTGTCAGCTTTTTTTTTTTTCTTCAACTTTTTTGTCAATGATTTTCTGTCAATGACTTTTTTGGTTAACGTTTTTTTGTCAACGTTTTTTTGTCCAATATTTTTGTCAATGTTTCTTAAAAGTGTCTGATAATTTGACCTTGATGTTGATTTTTTTCTAATATTTCCCAAAAAGATGTTTAACAGAGCAAGGAAATTTTCACAGTATTTCCTATCATTTTTTTCTTTTGGAAAAAAGTAAAAAAATGTTTTATTTCTGCTAGAACAAAAGCAGTTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17421
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Essential Splice Site 279 2167 None 36
ENSDART00000135604 Essential Splice Site 274 2142 None 36
Genomic Location (Zv9):
Chromosome 22 (position 17348059)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17099817
GRCz11 22 17126087
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTCAGAATCATGTTCAAAGCACAACACTGAATGATCACCTTCTCTCCT[A/T]GACCGAGAGTGTCTGGTTACCGGTATTGAWCCAGGGGGMGATGCAGAACC
Long Flanking Sequence:
TTATTTTAAGAAACGTTTAAAATATTTTAGAACAGTAAACATATCAGGCTGAATAGTTAAAATAAATCACTGACTTCTGCTGTCTGCATTAGTTATAAAAACACAGATTTCTTCACAACTTGAAGAGGCATCTTTGGACATCTTTCTTTCCTGTGGATTTAAAGTAAGCCTCTGCACTATTCGGGTCTATAACATGCTTGGAAGTTAATCCTAAGTGATTTGTTTTCTAAATGTTTCCTGAATCATGGGTTGACCAGTAACTTTTGATGTGGAGGGTCCTTTTTCGCTGGAGATACGGTTGCCCTAAAAACCAAAATAAAATAATTGTAAAAAAGCACATAAAAATGTACATATATCCTAGGAACGGAACAACAGAAAATTTTAGCGGTTCTAAAACCGTGACTTTTCCAAACCAAAGGTAAACCTTGACACTGGTTGTCATCCCATGCCTGCTCAGAATCATGTTCAAAGCACAACACTGAATGATCACCTTCTCTCCT[A/T]GACCGAGAGTGTCTGGTTACCGGTATTGATCCAGGGGGCGATGCAGAACCAGCCGCCTCACGCTGCCTTCATGTCCACCTTCATCCTGGAGGTAGATCAGTTCATCCTGACGCCTCTGAGCACCGCTGCGCTGGATGCCAAAGACGACGAGACACCGCAGGACCAGCTCATTTTCAGTGTCACCAAACCTCCAGCCGAAGGATATATAACTCATTTAGATGATCACACTAAAATGGCCTCCTCCTTCTCATGGCAAGACCTGAATGAGATGAAAATCGCATACCAGCCCCCAAACAGCAGTCATACAGCCAGGAGGAACTATGAGGTTGGTGAAGAATAGTACTCTGTTAGTGGAAATAAAAAATATGTTTGATCAAAAACCATGTCTGTCAGCCTAGCTTAGTGTTTATATATATATATATATATATATTAGGTGTGTAAACCACTGGTCTCACGATTCGGTTTGGTTTCGATTAGCATGCCTTCGGTTCGGATATCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29752
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Essential Splice Site 1116 2167 18 36
ENSDART00000135604 Essential Splice Site 1091 2142 18 36
Genomic Location (Zv9):
Chromosome 22 (position 17370524)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17122282
GRCz11 22 17148552
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCTTCCATCCCCTGGCTTCGAGAAAAGCAATGCTGGACTGAGAGTGGG[T/C]TAGTATGATTCCTGAGGTTTCTGTAAATGTACCCAGTGTCTGTGATCATG
Long Flanking Sequence:
TCAGTGCCCATTCTCCATTCATTATTTATCAGCACAGTAAATGGAAGCAGATGCCAGTAAGCATTGGCATGATGGCTTTATCAACACCCAGGTGGCAGCGGGCTGGCCGAGAGCCGAGCGGAGTGCAGGGGAAGAGAAGGGAGTGTTAGTGGGGTGGCGTAGCAGGCGTGAGGAAACAGGGGAGGAGGGGGTACTGCCTGTAAATGAGAGGAAGATGAAATTTTGGGACACTTTTAGTTTTCTAAAATGATATCTCTGTGGTTAGTGCCAATATTATTACTTACTGTATGCTATTCTAATATTGTTCCATCAGGCGGCATGATTGTGGTAGATGAAGGTGCCAGAGCATGTCTGTGTGGGGGGGTGTTGGAGGCCAGCGATCCTGATAGTCGTCCAGAAGAACTCATGTTTCACTTGGTCACCCCGCCTCAGTATGGGTTCCTGGAGAACACCCTTCCATCCCCTGGCTTCGAGAAAAGCAATGCTGGACTGAGAGTGGG[T/C]TAGTATGATTCCTGAGGTTTCTGTAAATGTACCCAGTGTCTGTGATCATGCCAAAAAAAAGTGTTGTCCAGGAATCCGTCAAACGAAATGACATTTTCTCTTTTAAATATAGTACAAATCAGTGACAATATTTCAACAAAAAATTTTACTCTGTCATCATTTACTCAACCTCATATCAATTCAAACTATGGATGCACTACATTTTGGCCACCAAAAATAATCTGCTCAAAAAGTCGTATTCGGTTTTCTCCAGATGTCCTTGCTTTAGCTCGCAGCTGATGACGTAGGCGATTGACAATGTAGGCGATTGTAGTGGACCTTATACCGCCCACTAAGGTAATGGCCATGCTACTGTGATGGTTGGGTTTAGGGTAGGGGGAGGTGTAGGCGATCGTCAACTACTTAGTGGACCTTGTACCACTCACTAAGGTTTGTTGCAAAATACCAAAGTATTCCACTTTGTGTAGCATGTACTACTCATGCTCACCGGAAAAGCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43806
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Nonsense 1242 2167 20 36
ENSDART00000135604 Nonsense 1217 2142 20 36
Genomic Location (Zv9):
Chromosome 22 (position 17373748)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17125506
GRCz11 22 17151776
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGTCTTGAGATGAATCGTTACAAAAGCATGAACCCAGAGGTTCTCCAA[C/T]AAACCTTAGCAATCCAGTCCTTCACCTTGGAGGAGCTACAGCAAGGTCAG
Long Flanking Sequence:
AGTGATCCTGGGAAAGTTGTTCACAATATTGATCATCCACAGAGTTTGTAATTTAGTCAAATGTTTACAAATACAAGCGCAGCCGTTTAAAGCTCATTTGTGGTAAATGATGTCAGAATTTACTGGTATTTTGGAATGGATGTGTGAATGCTCTTTTCCGGAAAATTTCCGTAACGTCCTCGCCTGTGTGAACAGCTTTTTTGAATATACCGGTAAAGTCGTTCCGGAAATTTTCCAGAAATTTACCGGTATCACTGTGTGAAAGGGGATATAGTCTTATAATCAGCAACTTCATGACTAGCTGTTGCACCTGTTAATAGGTCATGGAGGGAGGAATGAAGGATCTCAGCCCTGATATTCTAAACGCAGTGGACGTTGATATCCCAGCAGAAAGTCTCACCCTGACCATCTTGGATCCCCCAGCTCATGGCACTCTGATCAATGGCATATATGGTCTTGAGATGAATCGTTACAAAAGCATGAACCCAGAGGTTCTCCAA[C/T]AAACCTTAGCAATCCAGTCCTTCACCTTGGAGGAGCTACAGCAAGGTCAGTTCTTAAATTGGTAATGTTACAAACTTTCTCACCCAAATTCCAGGGTATCACTATTTGCTTGTTGAGAAAGGTTGTAAGGACAGCTTCCCTTATCAAGCACCCAACCACATCCCTTGGTGCCGTCACTGTGGGTACCCAGGCTAGCAGAACAGATGTTTCCAGAGACAAAGGTCACAATGTGCCTATGGTGCTTCTGCTTCATCTGCAAAGTCTTTCCAACTGCTCTAATCACAATTAAGTCACTGTGCATGAGGTGCTTGCTTGTTAGCAAGTGATAAAGCGCCATAGAAGTGTAGGTGAGCAGGTAACTGACAAAATGGGACATTTCGCTTCAACTAGAAGCTACCAGTCAGCGAACACCTTGTGACCGTTATATTGTAATTGCTACTAAATGCTTAATCCCCTAAAATCTGCTTTGAATTTCTCTCTCTTGTCCCGATCCATAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39368
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Nonsense 1244 2167 20 36
ENSDART00000135604 Nonsense 1219 2142 20 36
Genomic Location (Zv9):
Chromosome 22 (position 17373755)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17125513
GRCz11 22 17151783
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGATGAATCGTTACAAAAGCATGAACCCAGAGGTTCTCCAACAAACCT[T/G]AGCAATCCAGTCCTTCACCTTGGAGGAGCTACAGCAAGGTCAGTTCTTAA
Long Flanking Sequence:
CTGGGAAAGTTGTTCACAATATTGATCATCCACAGAGTTTGTAATTTAGTCAAATGTTTACAAATACAAGCGCAGCCGTTTAAAGCTCATTTGTGGTAAATGATGTCAGAATTTACTGGTATTTTGGAATGGATGTGTGAATGCTCTTTTCCGGAAAATTTCCGTAACGTCCTCGCCTGTGTGAACAGCTTTTTTGAATATACCGGTAAAGTCGTTCCGGAAATTTTCCAGAAATTTACCGGTATCACTGTGTGAAAGGGGATATAGTCTTATAATCAGCAACTTCATGACTAGCTGTTGCACCTGTTAATAGGTCATGGAGGGAGGAATGAAGGATCTCAGCCCTGATATTCTAAACGCAGTGGACGTTGATATCCCAGCAGAAAGTCTCACCCTGACCATCTTGGATCCCCCAGCTCATGGCACTCTGATCAATGGCATATATGGTCTTGAGATGAATCGTTACAAAAGCATGAACCCAGAGGTTCTCCAACAAACCT[T/G]AGCAATCCAGTCCTTCACCTTGGAGGAGCTACAGCAAGGTCAGTTCTTAAATTGGTAATGTTACAAACTTTCTCACCCAAATTCCAGGGTATCACTATTTGCTTGTTGAGAAAGGTTGTAAGGACAGCTTCCCTTATCAAGCACCCAACCACATCCCTTGGTGCCGTCACTGTGGGTACCCAGGCTAGCAGAACAGATGTTTCCAGAGACAAAGGTCACAATGTGCCTATGGTGCTTCTGCTTCATCTGCAAAGTCTTTCCAACTGCTCTAATCACAATTAAGTCACTGTGCATGAGGTGCTTGCTTGTTAGCAAGTGATAAAGCGCCATAGAAGTGTAGGTGAGCAGGTAACTGACAAAATGGGACATTTCGCTTCAACTAGAAGCTACCAGTCAGCGAACACCTTGTGACCGTTATATTGTAATTGCTACTAAATGCTTAATCCCCTAAAATCTGCTTTGAATTTCTCTCTCTTGTCCCGATCCATAGGAATGAAGAT
Associated Phenotype:
Not determined