Busch Lab

ZMP

znf319

Ensembl ID:
ENSDARG00000062401
ZFIN ID:
ZDB-GENE-090406-2
Human Orthologue:
ZNF319
Human Description:
zinc finger protein 319 [Source:HGNC Symbol;Acc:13644]
Mouse Orthologue:
Zfp319
Mouse Description:
zinc finger protein 319 Gene [Source:MGI Symbol;Acc:MGI:1890618]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa12083 Nonsense Available for shipment Available now
sa6128 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6127 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa711 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12083
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090226 Nonsense 21 584 1 3
Genomic Location (Zv9):
Chromosome 25 (position 14106454)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13578029
GRCz11 25 13674429
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCAAAGCTGAATCCATACACTAGAGCCCGGATGACGGAGGCGTGGCAG[C/T]AGCATGCTGTTGCCCCGCCTCCAGTGGTGCACAYCATCCCACCAGGGGCA
Long Flanking Sequence:
AGGGGGCTTTATACTGTGTGCCAGTTCTAGATAAGGCTTTCTTTGTAAAATTTGAATTGACATAATGTGCAAAGACAACTTTCAACTTATTATTGAATTACATATTTTGATACCAACAACTGGCTCAACTTCCTTTTTGTAGAGCTCTGCAATGTGATGAGCTGTAGTGTTTTGTTGAATGCATTTAATCTAATCTTTACCCTTATCTTCCTTCTACAGGAGATGAAGAAGCTCAAGTCCTTTTAAACTTTTGGATGTGGCTCACATCCATGTCAGTTCTTTGTTAAAATCAAACCATAACGTGTTGTTGACACGTTTCACTTTTTTCTCCATTTGTCGTCCTCACAAGAGCTGTCAAAATAAGTTCCTCTCTGCCTCCCCACCTTTCCCATCGCGGGCAGCCCAGCAATCCCTTCCCCCTGAATTCATCTGGAAAGAGGTCCAACTACAGCTCAAAGCTGAATCCATACACTAGAGCCCGGATGACGGAGGCGTGGCAG[C/T]AGCATGCTGTTGCCCCGCCTCCAGTGGTGCACACCATCCCACCAGGGGCAGATGCACTGGGCTGCACCGTCTATGGCATCGTCCTCCAGCCGGACACGACATTGCAGCAACAACAGCAGCAGCAACAACAACAGCAGCAGCACCACAGTCAGCAACACAACCAACAGCAGCAGCACCCGGCACAATCACAGCAGCCCTCACTGCATGTAGGCAATGAGGGAGGACATAAATGTGGTGCTTGTGGCCATGACATCTCCCATTTGGCTAATCCACATGAGCACCAGTGCATGGTAAGCCAAGACCGTTCATTTCAGTGCACGCAGTGTCTAAAGATCTTCCACCAAGCCACCGACCTGTTGGAGCACCAATGCGTGCAGGTGGAACAGAAACCCTTTGTTTGTGGAGTGTGCAAAATGGGCTTCTCCCTGCTAACTTCATTAGCACAGCATCACAATGCACATAACAGCGGCAACCCCATGAAGTGCTCTATATGTGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6128
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090226 Essential Splice Site 54 584 1 3
Genomic Location (Zv9):
Chromosome 25 (position 14106352)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13577927
GRCz11 25 13674327
KASP Assay ID:
554-3825.1 (used for ordering genotyping assays)
KASP Sequence:
ATGCACTGGGCTGCACCGTCTATGGCATCGTCCTSCAGCCGGACACGACA[T/C]TGCAGCAACAACARCAGCANNNGCARCAACAACAGCAGCAGCACCACAGTCAG
Long Flanking Sequence:
TATTTTGATACCAACAACTGGCTCAACTTCCTTTTTGTAGAGCTCTGCAATGTGATGAGCTGTAGTGTTTTGTTGAATGCATTTAATCTAATCTTTACCCTTATCTTCCTTCTACAGGAGATGAAGAAGCTCAAGTCCTTTTAAACTTTTGGATGTGGCTCACATCCATGTCAGTTCTTTGTTAAAATCAAACCATAACGTGTTGTTGACACGTTTCACTTTTTTCTCCATTTGTCGTCCTCACAAGAGCTGTCAAAATAAGTTCCTCTCTGCCTCCCCACCTTTCCCATCGCGGGCAGCCCAGCAATCCCTTCCCCCTGAATTCATCTGGAAAGAGGTCCAACTACAGCTCAAAGCTGAATCCATACACTAGAGCCCGGATGACGGAGGCGTGGCAGCAGCATGCTGTTGCCCCGCCTCCAGTGGTGCACACCATCCCACCAGGGGCAGATGCACTGGGCTGCACCGTCTATGGCATCGTCCTCCAGCCGGACACGACA[T/C]TGCAGCAACAACAGCAGCAGCAACAACAACAGCAGCAGCACCACAGTCAGCAACACAACCAACAGCAGCAGCACCCGGCACAATCACAGCAGCCCTCACTGCATGTAGGCAATGAGGGAGGACATAAATGTGGTGCTTGTGGCCATGACATCTCCCATTTGGCTAATCCACATGAGCACCAGTGCATGGTAAGCCAAGACCGTTCATTTCAGTGCACGCAGTGTCTAAAGATCTTCCACCAAGCCACCGACCTGTTGGAGCACCAATGCGTGCAGGTGGAACAGAAACCCTTTGTTTGTGGAGTGTGCAAAATGGGCTTCTCCCTGCTAACTTCATTAGCACAGCATCACAATGCACATAACAGCGGCAACCCCATGAAGTGCTCTATATGTGAAAAAACCTATCGGCCGGGCTCTGGAAACGCCACCCCAACTTCATCATCGGCTACCCCAGGGCAGCCATCAAATGATGAAGCATCGTCCAGTGGCAGCGCTGCTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30221
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090226 Nonsense 55 584 2 3
Genomic Location (Zv9):
Chromosome 25 (position 14106265)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13577840
GRCz11 25 13674240
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCACCACAGTCAGCAACACAACCAACAGCAGCAGCACCCGGCACAATCA[C/T]AGCAGCCCTCACTGCATGTAGGCAATGAGGGAGGACATAAATGTGGTGCT
Long Flanking Sequence:
CTAATCTTTACCCTTATCTTCCTTCTACAGGAGATGAAGAAGCTCAAGTCCTTTTAAACTTTTGGATGTGGCTCACATCCATGTCAGTTCTTTGTTAAAATCAAACCATAACGTGTTGTTGACACGTTTCACTTTTTTCTCCATTTGTCGTCCTCACAAGAGCTGTCAAAATAAGTTCCTCTCTGCCTCCCCACCTTTCCCATCGCGGGCAGCCCAGCAATCCCTTCCCCCTGAATTCATCTGGAAAGAGGTCCAACTACAGCTCAAAGCTGAATCCATACACTAGAGCCCGGATGACGGAGGCGTGGCAGCAGCATGCTGTTGCCCCGCCTCCAGTGGTGCACACCATCCCACCAGGGGCAGATGCACTGGGCTGCACCGTCTATGGCATCGTCCTCCAGCCGGACACGACATTGCAGCAACAACAGCAGCAGCAACAACAACAGCAGCAGCACCACAGTCAGCAACACAACCAACAGCAGCAGCACCCGGCACAATCA[C/T]AGCAGCCCTCACTGCATGTAGGCAATGAGGGAGGACATAAATGTGGTGCTTGTGGCCATGACATCTCCCATTTGGCTAATCCACATGAGCACCAGTGCATGGTAAGCCAAGACCGTTCATTTCAGTGCACGCAGTGTCTAAAGATCTTCCACCAAGCCACCGACCTGTTGGAGCACCAATGCGTGCAGGTGGAACAGAAACCCTTTGTTTGTGGAGTGTGCAAAATGGGCTTCTCCCTGCTAACTTCATTAGCACAGCATCACAATGCACATAACAGCGGCAACCCCATGAAGTGCTCTATATGTGAAAAAACCTATCGGCCGGGCTCTGGAAACGCCACCCCAACTTCATCATCGGCTACCCCAGGGCAGCCATCAAATGATGAAGCATCGTCCAGTGGCAGCGCTGCTGTTGGGACATCAGGCCAGCCTACGTTTGAGCCTTCACATCCTGACAGACCCTACAAGTGTTCAGTGTGCACCAAGGGCTTCCGTCACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6127
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090226 Essential Splice Site 428 584 2 3
Genomic Location (Zv9):
Chromosome 25 (position 14105144)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13576719
GRCz11 25 13673119
KASP Assay ID:
554-3824.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGGCAAGGGCTTCAGCCAGTCCGGRGAGCTGCTTCGTCAYAAATGTGG[T/C]GAGTCTTCCTCAACACCCACAAATCCAGACAAGCCCTACAAGTGTGACGT
Long Flanking Sequence:
GAACGGCCATTCAAGTGCGCAGTGTGCGAAAAGAGCTTCAAGCATCGCTCCCATCTAGTCCGTCACATGTATGCCCACTCGGGCGAGCACTTGTTCAAGTGCAACCTTTGCGAGTTGCATTTCAAAGAGTCTTCCGAGCTCCTCCATCACCAGTGTCAGCCTCAGGGTGCTCGGCCATTTCGCTGTGCCACTTGTGGGAAGGGATTCAAGCGTCCTTCCGACCTGAGGCAACACGAACGCACTCACTCGGAGGAACGCCCATTCCACTGTGAAGACTGCCAGATGAGCTTTAAACAACAATACGCCCTGGTGCGCCACCGACGTACACACAAGCCCTCCGCTGACCGCCCTTTCAAATGCAACCTGTGCGACAAGGGCTTCCTGCAGCCGTCACATCTGTTGTACCACCAGCATGTTCATGGCATGGACAACCTCTTCAAGTGTGCATCGTGTGGCAAGGGCTTCAGCCAGTCCGGGGAGCTGCTTCGTCACAAATGTGG[T/C]GAGTCTTCCTCAACACCCACAAATCCAGACAAGCCCTACAAGTGTGACGTGTGCGGAAAGGCTTACAAGAAGGCCACAACTCTACAGCGGCATCAGAACTCCCACTGCACAGAGAAACCTCTCAAGTGCTCGCTGTGTGACCGACGCTTCCTTTCCTCCTCAGAGTTTGTGCAGCATCGATGCGACCCATCCCGGGAGAAACCCCTGAAGTGTCCGGACTGTGAGAAGCGCTTCAAGTATTCCTCAGAGATGCAGCGCCACAGGCGCGTCCACACTGGAGAGAAGCCTTACAAGTGTGCCAGCTGTGACAAGGGCTTCAAGCAGCGTGAACATCTAGCCAAGCATCAAAGTGTGCATGCAAGAGATGCTCAGTTTAAATGTGTATGGTGTGGAGAGCGCTTTGCTGATCTAGGGGCCCTTCAGGAGCACACTGTCCAGCACACAGCTGAAGGTGGGGGCTACCCTGTGTCCTCTCTCATTCAATAACTTTTGCCCCTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa711
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090226 Nonsense 465 584 3 3
Genomic Location (Zv9):
Chromosome 25 (position 14105020)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13576595
GRCz11 25 13672995
KASP Assay ID:
554-0619.1 (used for ordering genotyping assays)
KASP Sequence:
CCACAACTCTACAGCGGCATCAGAACTCCCACTGCACAGAGAAACCTCTC[A/T]AGTGCTCGCTGTGTGACCGACGCTTCCTTTCCTCCTCAGAGTTTGTGCAG
Long Flanking Sequence:
AAGAGTCTTCCGAGCTCCTCCATCACCAGTGTCAGCCTCAGGGTGCTCGGCCATTTCGCTGTGCCACTTGTGGGAAGGGATTCAAGCGTCCTTCCGACCTGAGGCAACACGAACGCACTCACTCGGAGGAACGCCCATTCCACTGTGAAGACTGCCAGATGAGCTTTAAACAACAATACGCCCTGGTGCGCCACCGACGTACACACAAGCCCTCCGCTGACCGCCCTTTCAAATGCAACCTGTGCGACAAGGGCTTCCTGCAGCCGTCACATCTGTTGTACCACCAGCATGTTCATGGCATGGACAACCTCTTCAAGTGTGCATCGTGTGGCAAGGGCTTCAGCCAGTCCGGGGAGCTGCTTCGTCACAAATGTGGTGAGTCTTCCTCAACACCCACAAATCCAGACAAGCCCTACAAGTGTGACGTGTGCGGAAAGGCTTACAAGAAGGCCACAACTCTACAGCGGCATCAGAACTCCCACTGCACAGAGAAACCTCTC[A/T]AGTGCTCGCTGTGTGACCGACGCTTCCTTTCCTCCTCAGAGTTTGTGCAGCATCGATGCGACCCATCCCGGGAGAAACCCCTGAAGTGTCCGGACTGTGAGAAGCGCTTCAAGTATTCCTCAGAGATGCAGCGCCACAGGCGCGTCCACACTGGAGAGAAGCCTTACAAGTGTGCCAGCTGTGACAAGGGCTTCAAGCAGCGTGAACATCTAGCCAAGCATCAAAGTGTGCATGCAAGAGATGCTCAGTTTAAATGTGTATGGTGTGGAGAGCGCTTTGCTGATCTAGGGGCCCTTCAGGAGCACACTGTCCAGCACACAGCTGAAGGTGGGGGCTACCCTGTGTCCTCTCTCATTCAATAACTTTTGCCCCTAGCTAAGATTTGAATTGAATTAGCAATCCTACCAAACTACCCTGGTCAATTTAATCCTTACAAGGCCCAGTAACCACACGATACCTCATTTTGTGAAAAATGTGCATATGCACAAGTAGTTATCCCT
Associated Phenotype:
Not determined