Busch Lab

ZMP

flcn

Ensembl ID:
ENSDARG00000062385
ZFIN ID:
ZDB-GENE-060421-3470
Description:
folliculin [Source:RefSeq peptide;Acc:NP_001035463]
Human Orthologue:
FLCN
Human Description:
folliculin [Source:HGNC Symbol;Acc:27310]
Mouse Orthologue:
Flcn
Mouse Description:
folliculin Gene [Source:MGI Symbol;Acc:MGI:2442184]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
e36 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
e36
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090191 Nonsense 12 558 2 12
ENSDART00000135245 Nonsense 12 194 2 4
Genomic Location (Zv9):
Chromosome 16 (position 15573871)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13932330
GRCz11 16 13822450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTTGTTTCCTCCAGATGAACGCTTTAGTTGCCCTGTGCCACTTTTGT[G/T]AGCTCCATGGCCCACGGACGCTGTTTTGTACCGAAGCCGTCCACCCTCCG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28609
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090191 Nonsense 513 558 12 12
ENSDART00000135245 None None 194 None 4
Genomic Location (Zv9):
Chromosome 16 (position 15596770)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13955229
GRCz11 16 13845349
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTTCTCTAAAGTGGACGGCAGAGGTAAAGAGGACACCCAAAAGGTTT[T/A]GGCCCTGCTGGGGGCCACGGGGCCAGGAGAAGAGGACAATGTGCGGCTTC
Associated Phenotype:
Not determined