Busch Lab

ZMP

snapin

Ensembl ID:
ENSDARG00000062382
ZFIN ID:
ZDB-GENE-060503-343
Description:
SNARE-associated protein Snapin [Source:RefSeq peptide;Acc:NP_001038613]
Human Orthologue:
SNAPIN
Human Description:
SNAP-associated protein [Source:HGNC Symbol;Acc:17145]
Mouse Orthologue:
Snapin
Mouse Description:
SNAP-associated protein Gene [Source:MGI Symbol;Acc:MGI:1333745]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa23524 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23524
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090200 Essential Splice Site 94 129 3 4
Genomic Location (Zv9):
Chromosome 19 (position 24406141)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24336253
GRCz11 19 23920476
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCAGGAGAAGAGTGGTGCTTGTCAACAACATACTCCAAAATGCACAGG[T/A]AAGTTAGTGTAAACATCGTTCTATATGCACACATCCTTAGATCTTTTTTA
Associated Phenotype:
Not determined