Busch Lab

ZMP

si:dkey-125i10.5

Ensembl ID:
ENSDARG00000062362
ZFIN ID:
ZDB-GENE-060526-199
Description:
Novel protein similar to vertebrate two pore segment channel 1 (TPCN1) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
TPCN1
Human Description:
two pore segment channel 1 [Source:HGNC Symbol;Acc:18182]
Mouse Orthologue:
Tpcn1
Mouse Description:
two pore channel 1 Gene [Source:MGI Symbol;Acc:MGI:2182472]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa135 Nonsense F2 line generated Not yet available
sa31430 Nonsense Available for shipment Available now
sa33584 Nonsense Available for shipment Available now
sa20394 Nonsense Available for shipment Available now
sa31431 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa135
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090102 Nonsense 75 644 2 21
ENSDART00000138123 Nonsense 100 805 3 26
Genomic Location (Zv9):
Chromosome 5 (position 24881251)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22708516
GRCz11 5 23212316
KASP Assay ID:
554-1448.1 (used for ordering genotyping assays)
KASP Sequence:
AGTGCCCATGCGCTCAGTGCCTACCTGTTTGCTCACAGTCATCTGTTCTA[T/A]GTGGTGGAGCTTCTGACTGCGGTGTTACTCATGCTCCTGTCCCTCTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31430
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090102 Nonsense 336 644 9 21
ENSDART00000138123 Nonsense 361 805 10 26
Genomic Location (Zv9):
Chromosome 5 (position 24887660)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22714925
GRCz11 5 23218725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCCAGATGGCGTGTCTTTGAAACAGTTTGATGGACTGATGCGATTTTA[T/A]CATCCACGAATGACTCCACGTGATCGCTTTCTTACTTTTAAAGCCCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33584
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090102 Nonsense 520 644 17 21
ENSDART00000138123 Nonsense 544 805 18 26
Genomic Location (Zv9):
Chromosome 5 (position 24892376)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22719641
GRCz11 5 23223441
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATAATTTTTTTCATTTCTTATTAAGGTTATTTAAAATTAAACAGCGCTA[T/A]CGGAATGTTCTGGACACAATGTTTGAACTGTTCCCGCGCATGGCCAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20394
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090102 Nonsense 576 644 19 21
ENSDART00000138123 Nonsense 600 805 20 26
Genomic Location (Zv9):
Chromosome 5 (position 24892770)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22720035
GRCz11 5 23223835
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTATGATGTCTTTTCAATAGCAATAGCACCGTCGCGGCCTCCTATCGG[C/T]AGATAAATGTCACCACTGGCAACCGGACCGAATTACAAGAGGGATATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31431
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090102 Nonsense 593 644 19 21
ENSDART00000138123 Nonsense 617 805 20 26
Genomic Location (Zv9):
Chromosome 5 (position 24892823)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22720088
GRCz11 5 23223888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAATGTCACCACTGGCAACCGGACCGAATTACAAGAGGGATATTACTA[T/G]CTCAATAACTTCAATAACATCCTAAGCAGCTTTGGTATGTGCACACAGCC
Associated Phenotype:
Not determined