Busch Lab

ZMP

si:ch211-247j24.2

Ensembl ID:
ENSDARG00000062328
ZFIN ID:
ZDB-GENE-091118-124
Human Orthologue:
RASGRP2
Human Description:
RAS guanyl releasing protein 2 (calcium and DAG-regulated) [Source:HGNC Symbol;Acc:9879]
Mouse Orthologue:
Rasgrp2
Mouse Description:
RAS, guanyl releasing protein 2 Gene [Source:MGI Symbol;Acc:MGI:1333849]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa3110 Essential Splice Site F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29615
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089980 Essential Splice Site 387 593 9 15
ENSDART00000132844 Essential Splice Site 359 547 8 13
Genomic Location (Zv9):
Chromosome 21 (position 27817770)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28386681
GRCz11 21 28423376
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATACCAGCTGTCTCTACAGAGGGAGCCTCGCAGTATTAAACTCTCGG[T/C]GAGTCACACACCACCAACATAAAAACTGCTCAGATAGCAAATCAGTAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3110
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089980 Essential Splice Site 509 593 12 15
ENSDART00000132844 Essential Splice Site 481 547 11 13
Genomic Location (Zv9):
Chromosome 21 (position 27814033)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28382944
GRCz11 21 28419639
KASP Assay ID:
554-2501.1 (used for ordering genotyping assays)
KASP Sequence:
CAGAGACGAGCAGCATCAAGCCTTCATTTTGTCGCCACTGCTCTCGCTTG[G/A]TAAGTACACGTTTTATTTGTGGCTCAAACTCTTTATCTTCATCTCCAACG
Associated Phenotype:
Not determined