Busch Lab

ZMP

wu:fj40f01

Ensembl ID:
ENSDARG00000062323
Human Orthologue:
ADAM23
Human Description:
ADAM metallopeptidase domain 23 [Source:HGNC Symbol;Acc:202]
Mouse Orthologue:
Adam23
Mouse Description:
a disintegrin and metallopeptidase domain 23 Gene [Source:MGI Symbol;Acc:MGI:1345162]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9934 Nonsense Available for shipment Available now
sa20667 Nonsense Available for shipment Available now
sa17371 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1821
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089934 Missense 53 774 2 27
Genomic Location (Zv9):
Chromosome 6 (position 13096045)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12952535
GRCz11 6 13186070
KASP Assay ID:
554-1813.1 (used for ordering genotyping assays)
KASP Sequence:
TCAGGGATCAGCACGTGTCTGAGACCCCGCGAGAGGCGACAGCACCGGAC[G/T]ATTCGACCGAAGRCAAAACAGGAGAGCACCCTGTCACCATCACATATCCC
Long Flanking Sequence:
CGCTGCATCTTAATTCGATTACCATGACAATAGATTATTATTAGCTGACGTGATGCTCATCTAATGCCTTTACCGTTCAGATATCGCATATCCGAATATACAGCTGATAAAAGTTGAGAAAAATGCATATGGGTGCGTTTTGTCAATAAGTGTCTCTCGTTTCTCTGTTGCCATCGCATGTATCATGTCTCGCCCTCTCACCCACTGTCTTGCATTTGTGATCAGATTTCAGTGTTTTATTTGGTTATCATCCGTAGTGCCTCCGTTCGATACACACAGAGATCTGCATAAGAGAGATCTGTGCGCAGCTTCTCTGCAGCATCACAGGGCTGCAACCGCTGGCACACGTTCATATATAATTGACAGGATCCCTCTCTGAGATGGAGACTGTAAAGCAGTAAACAGTTTCCTCCTGTCCTGCAGTTTCCAGCTCCGTGCAGAATGAGGCTCTCAGGGATCAGCACGTGTCTGAGACCCCGCGAGAGGCGACAGCACCGGAC[G/T]ATTCGACCGAAGGCAAAACAGGAGAGCACCCTGTCACCATCACATATCCCTCCCGGCTCATCTACTACCTGAACGAGGAGTCGGAGAGCACCTTTCATGACCTGGACACTCGGGCGAAGAACCAGGCTGGAGACGGACAGGTGAGAGTGTAAACTGTGACAGCCGCCCTCAACTTTACAAATCTAGCCCTCTCCGCTAACACTCATGCACTAATAATGAGTTATAGAGCGAGTGAGTTGCTTCATTCGACAGCAGCTGGGAATGGTGCAGTGTGCCCAATGCTCAGAGCTGATCCAGGTTCACTGGCCCTCCCTCACAAATCTAACACACTTTTCGCAAAAGAAGCAGTTTTCACTCCCCCCTCCGCTCTCTGTGGCCAACAGACGTTGTGGGATTGCATTGTGCGCACACTTTCACTTTACTTCTGCCAATGCAGTATTTTTGCTGTAAAACAGCACAGCTGTGTGATTTATGATGCTCCTGAGCAGATGTTTTGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9934
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089934 Nonsense 68 774 2 27
Genomic Location (Zv9):
Chromosome 6 (position 13095998)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12952488
GRCz11 6 13186023
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACKATTCGACCGAAGRCAAAACAGGAGAGCACCCTGTCACCATCACATA[T/A]CCCTCCCGGCTCATCTACTACCTGAACGAGGAGTCGGAGAGCACCTTTCA
Long Flanking Sequence:
ACGTGATGCTCATCTAATGCCTTTACCGTTCAGATATCGCATATCCGAATATACAGCTGATAAAAGTTGAGAAAAATGCATATGGGTGCGTTTTGTCAATAAGTGTCTCTCGTTTCTCTGTTGCCATCGCATGTATCATGTCTCGCCCTCTCACCCACTGTCTTGCATTTGTGATCAGATTTCAGTGTTTTATTTGGTTATCATCCGTAGTGCCTCCGTTCGATACACACAGAGATCTGCATAAGAGAGATCTGTGCGCAGCTTCTCTGCAGCATCACAGGGCTGCAACCGCTGGCACACGTTCATATATAATTGACAGGATCCCTCTCTGAGATGGAGACTGTAAAGCAGTAAACAGTTTCCTCCTGTCCTGCAGTTTCCAGCTCCGTGCAGAATGAGGCTCTCAGGGATCAGCACGTGTCTGAGACCCCGCGAGAGGCGACAGCACCGGACGATTCGACCGAAGGCAAAACAGGAGAGCACCCTGTCACCATCACATA[T/A]CCCTCCCGGCTCATCTACTACCTGAACGAGGAGTCGGAGAGCACCTTTCATGACCTGGACACTCGGGCGAAGAACCAGGCTGGAGACGGACAGGTGAGAGTGTAAACTGTGACAGCCGCCCTCAACTTTACAAATCTAGCCCTCTCCGCTAACACTCATGCACTAATAATGAGTTATAGAGCGAGTGAGTTGCTTCATTCGACAGCAGCTGGGAATGGTGCAGTGTGCCCAATGCTCAGAGCTGATCCAGGTTCACTGGCCCTCCCTCACAAATCTAACACACTTTTCGCAAAAGAAGCAGTTTTCACTCCCCCCTCCGCTCTCTGTGGCCAACAGACGTTGTGGGATTGCATTGTGCGCACACTTTCACTTTACTTCTGCCAATGCAGTATTTTTGCTGTAAAACAGCACAGCTGTGTGATTTATGATGCTCCTGAGCAGATGTTTTGTCTATAGATGCACTTTGCTTGTTGGGAATATGACTTAATGTGCGAGCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20667
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089934 Nonsense 137 774 4 27
Genomic Location (Zv9):
Chromosome 6 (position 13081026)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12937516
GRCz11 6 13171051
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTTTTATTTCAGTGATCTACTGTCTTCAGATTACATCGAGATCCACTA[T/A]GAGAACGACAAGCCAGTTCTATCCAGGGTAAGACACAGAGAGCAGCACAC
Long Flanking Sequence:
CTTGAGTTATATAAAACTTATTAATAAAAATCTTCTGCCTTGTTCAGGATTTACAATGGTGCATGGAGCACATCTATTCCAAATAAAAATTGATGAATGATGCATTTTTGCAAAGAAAATATACATATTTAAAACTTCATAAACAATTTTATGTAACTTCCATGAGAATCTGCTGTTCTTCATTTGAGGTGCATATTTGTGGTGCATCTACCTCTTTTTAAATCAGGGGTTCATTTGAATTTTTGTGTGAACAAGGCCTTTAACAATCCTGATGACGTGGTGCAGCTTGGGATCCGCCACCGTCCCACAGCTGGAACTGCTGATACAAAGGAGAGTGTTCTCCCACTGCGCGCAACTCAATCTCAGTGGTGCATTGGATTTGGGGCGCTAACTTTATCTTTGAGCTGTTGGATAATTAATGCAAGACTGCCCTTTGAAATCTGTCTCTCGCCCTTTTATTTCAGTGATCTACTGTCTTCAGATTACATCGAGATCCACTA[T/A]GAGAACGACAAGCCAGTTCTATCCAGGGTAAGACACAGAGAGCAGCACACTAATATCTGAAAATAACTACATCATGCAATGCTGAATGTGCGTTTGTTTAGGGAGGGGAGCACTGCTATTACCACGGCCATGTGAGAGGAAAAGAAGACTCCCGTGCAGCCTTATCCACCTGCAACGGGCTTCAGTAAGCAACCTTGATTTTATTTAAATACAGTACTGTCTAAAAGTCTTAGACCCCCAGTTACATTTGTTGTTTTAGTGAGGGTGTAATGACATTATATATTACTTCTCAATCTCTTGATTAAAATACATCTAGAAAATACAGGTTCTAGTTGAATTTTTTGGGTCTAATTGTTTGAGACATATGAAAGAAAGAGTTAGAGAAAGATGGAAACGTAAAATACTACGTTTAAGTCTTGGTTTGATTTGCATTTTTGCCAGAGCTGTTGTCATTATTGCCTGAATTGATGGGATTGTGATGGCTGAAAAGGACAGACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17371
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089934 Nonsense 206 774 7 27
Genomic Location (Zv9):
Chromosome 6 (position 13075863)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12932353
GRCz11 6 13165888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AWATACTCTTTRTATTTTAGGAGACAGAGGCGCGGCCTCACACWTTACGA[C/T]GAACRTCATCTCTCGGTYTGACCWCTATCCCAGATGACTGGAGTAAGTGT
Long Flanking Sequence:
ACTTAATAAAAATTATAGATTAACATAGTATATATTGAACACTGTAGTTGTTTTAATACATGTACATAAGTTAAAGTAAATGAAAATGAGAAATATTTGCTTGGCAACTAGGTGAAATAAAAGGTGTTTTTGTGTGTTACAGGCTCTTATATCTAGGTTCAGTTATTTCACTTTTATGGCACGGAATAGGTTACTTTAAAAATAGGTTACCTTTTTACTCAAACAATTTGCTAGTAAATCCAGTACATTTAGAAAATCTAAGAATTTCTATTATTGTAAATATAACATTGCAGTTATTATTTAGTTTAAACTGTAATAATAAACATAAAAATTTAATAAGCACATAAAAATTGTTCTACATGTCTATTCATAAAATTATGAACGTACTTCATGGCTTGTGGTAAAAATATATATTGTCAGCTACATTTTTCAAGTCAGTGTCAAATATTGATATACTCTTTATATTTTAGGAGACAGAGGCGCGGCCTCACACTTTACGA[C/T]GAACGTCATCTCTCGGTCTGACCTCTATCCCAGATGACTGGAGTAAGTGTGCCGAAGTCTTAAAGATACGTAGCCAGATATTATACGCTCACCCTCATCTCCATGGTTACCTTCTTGTCTGTTTCCCACAGCTGCTGATGACCCAGATGAGGAAAAGCGTATTTTCGCCAGCATGCCTTGGCTAAAGAGAAGGAGGAAAAGAGCTGTAAGAACATGACCTGTGAAAAAACCACAACTGTGTTTCTGTGAAAAATTCTAGAACTTCCATACCTCATACTTCAACGTCTTGCTTTTATTTTAAAATCCTTTTTTGTTTTCCTAGATGCCACGTAACATTTTTGAGGAAATGAAGTATCTGGAAATAATGATCGTTGCTGATCACAATACGGTGGGTTCATCTCTGACTCATTACATTCATAATATATAAATGTTGATTTTTATCATTTTTTTATGTATTTTTGCTCTGAAATTGCCAGGGCATTTGATTTTAAAGGGATAGT
Associated Phenotype:
Not determined