Busch Lab

ZMP

SIK2 (1 of 2)

Ensembl ID:
ENSDARG00000062315
Description:
salt-inducible kinase 2 [Source:HGNC Symbol;Acc:21680]
Human Orthologue:
SIK2
Human Description:
salt-inducible kinase 2 [Source:HGNC Symbol;Acc:21680]
Mouse Orthologue:
Sik2
Mouse Description:
salt inducible kinase 2 Gene [Source:MGI Symbol;Acc:MGI:2445031]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35875 Nonsense Mutation detected in F1 DNA Not yet available
sa35874 Essential Splice Site Available for shipment Available now
sa15208 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35875
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089953 Nonsense 286 896 7 15
Genomic Location (Zv9):
Chromosome 15 (position 20760076)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21862702
GRCz11 15 21798434
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACAAGTGGATGGTGATGGAGGTGCCTGTGCAGCGACCGATGTTGTAC[C/T]AGCAGACCACAGAGGGAGAGGCTGGAGTGGGCGAATACAACGAACAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35874
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089953 Essential Splice Site 686 896 13 15
Genomic Location (Zv9):
Chromosome 15 (position 20748252)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21850878
GRCz11 15 21786610
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCAAGGAGACAGAGTCTGGAGCCGCAGTACCTCCCCCACAGAATACAG[G/A]TGACGCACATCATGCAGCTAACACTCACTTTAGCTCATCTGAGATACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15208
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089953 Nonsense 839 896 15 15
Genomic Location (Zv9):
Chromosome 15 (position 20745638)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21848264
GRCz11 15 21783996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAACCCCTCAACTACACCTATCCACCCTGTGACCCAAGCCACTCGCCAT[C/A]AGGAGAAGCACTGTACCCGGAGCAATACGACTACCCTCTTGATCCAGGGC
Associated Phenotype:
Not determined