Busch Lab

ZMP

si:ch211-239d6.1

Ensembl ID:
ENSDARG00000062305
ZFIN ID:
ZDB-GENE-060503-788
Description:
regulating synaptic membrane exocytosis protein 3 [Source:RefSeq peptide;Acc:NP_001093479]
Human Orthologue:
RIMS3
Human Description:
regulating synaptic membrane exocytosis 3 [Source:HGNC Symbol;Acc:21292]
Mouse Orthologue:
Rims3
Mouse Description:
regulating synaptic membrane exocytosis 3 Gene [Source:MGI Symbol;Acc:MGI:2443331]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa36843 Nonsense Available for shipment Available now
sa36842 Nonsense Mutation detected in F1 DNA Not yet available
sa1224 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36843
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104027 Nonsense 209 319 5 6
ENSDART00000139766 Nonsense 92 202 3 4
Genomic Location (Zv9):
Chromosome 19 (position 25652271)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25582383
GRCz11 19 25166606
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATACACTGGATGTTTTCTTCTCTGTCAGCAACATATATAAAGGTTTA[T/A]GTCCTGGAGAACGGGATGTGTCTTGCTAAGAAGAAAACCAAAGTGGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36842
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104027 Nonsense 244 319 5 6
ENSDART00000139766 Nonsense 127 202 3 4
Genomic Location (Zv9):
Chromosome 19 (position 25652168)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25582280
GRCz11 19 25166503
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACCCTGGATCCAACCTTCCAGCAGTCCCTGATGTTTGATGAGAGCCCG[C/T]AGGGGAAAGTGCTACAGGTATCACAAATTATATAAAGCACTCTGAGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1224
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104027 Nonsense 256 319 6 6
ENSDART00000139766 Nonsense 139 202 4 4
Genomic Location (Zv9):
Chromosome 19 (position 25649397)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25579509
GRCz11 19 25163732
KASP Assay ID:
554-1133.1 (used for ordering genotyping assays)
KASP Sequence:
AAAATGATCTTTCATGTATAACTTTCCCAGGTGATCGTGTGGGGTGAYTA[C/A]GGCCGCATGGACAGCAAGTGTTTCATGGGAATGGCTCAGATCCTCCTGGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461