Busch Lab

ZMP

znf652

Ensembl ID:
ENSDARG00000062302
ZFIN ID:
ZDB-GENE-030131-5857
Human Orthologue:
ZNF652
Human Description:
zinc finger protein 652 [Source:HGNC Symbol;Acc:29147]
Mouse Orthologue:
Zfp652
Mouse Description:
zinc finger protein 652 Gene [Source:MGI Symbol;Acc:MGI:2442221]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19968 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19968
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089923 Essential Splice Site 149 617 2 7
ENSDART00000146651 None None 247 None 6
Genomic Location (Zv9):
Chromosome 3 (position 15381040)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15626641
GRCz11 3 15776441
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGAGGAGGATGAAGATGAGGATGATGAGGAGGAGGAGGAGGAAGAGGA[C/A]AGTGTTGAAGAGAACTACAGTGATCTGGATGAAGATGAAGAAGAGGAGGA
Long Flanking Sequence:
GGTCAACTGCCCATGAAGTCCTGCCAGACACTGAGGGAAGAGCTGTCCGGCCTGGAGGCGATGACCGAAGAAGAGCGGCCAATGACGCAACCTTCCCAAACGTACATCCACAACACCTCCGCTCCTCATTCTGAACTATCGCCCAAGATTTACAAGCGAGAAGCTGAGGATACACCGTACTCCTTGGCCATCGACAGCACAATGGCTACAGATTCGCAAATGCCCTCAGAGCTGAACCCTGCCCCGAATCAGCCGTTTTACCGGGAAGGGGCTCCGGCAAAGACTGGAAACGGAGGAACATCGGATGATTCGGAAGCTGACGATTCAGGAGCCGGAGCGGAGGACGAGTTTAAACGAGGGCAGATCATCGTTGAGGTCAACCTAAATAACCAAACCCTGCACGTGTCCAAAGGAGACGATGCGGGGAACGCTGCCGGAGATAAGAGCAATAGTGAGGAGGATGAAGATGAGGATGATGAGGAGGAGGAGGAGGAAGAGGA[C/A]AGTGTTGAAGAGAACTACAGTGATCTGGATGAAGATGAAGAAGAGGAGGAGGAGAATAATAGTCGGCGTACAAGAGCACAGCGGGCGCAGAGGGGACGGACCACCGCTCAGCCGCGCCGAAAAAGTCGTCGAGTCGCTGCTTCGAGTGTGACATCATCTGGTGTGACCACCAGGGGGCGGAGGAAGCATGCGGAAGCCCCGCCCCAAAAGTGCAGACCAGCCAAGGAGGCCAAAAGCTCCGCCTCTTCTGCATCTGGAGCCACACCCACTGGAGGAGGTGCCAAGGGAGAGGGGGAGGAGAAAGAGACGCTGGCGTGTGAAAAATGCCCGCGCGTGTTTAACACTCGCTGGTACCTGGAGAAGCACATGAACGTGACGCACAGGCGCATGCAGATCTGCGACAAGTGTGGGAAGAAGTTCGTGTTGGAGAGTGAGCTGGCTCTGCACCAGCAGACAGACTGCGAGAAGAATATTCAGGTAAAGAGCAGCTTCACAGGTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26019
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089923 Nonsense 257 617 2 7
ENSDART00000146651 Nonsense 40 247 2 6
Genomic Location (Zv9):
Chromosome 3 (position 15381367)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15626968
GRCz11 3 15776768
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGCCAAGGGAGAGGGGGAGGAGAAAGAGACGCTGGCGTGTGAAAAATG[C/A]CCGCGCGTGTTTAACACTCGCTGGTACCTGGAGAAGCACATGAACGTGAC
Long Flanking Sequence:
GGAGCCGGAGCGGAGGACGAGTTTAAACGAGGGCAGATCATCGTTGAGGTCAACCTAAATAACCAAACCCTGCACGTGTCCAAAGGAGACGATGCGGGGAACGCTGCCGGAGATAAGAGCAATAGTGAGGAGGATGAAGATGAGGATGATGAGGAGGAGGAGGAGGAAGAGGACAGTGTTGAAGAGAACTACAGTGATCTGGATGAAGATGAAGAAGAGGAGGAGGAGAATAATAGTCGGCGTACAAGAGCACAGCGGGCGCAGAGGGGACGGACCACCGCTCAGCCGCGCCGAAAAAGTCGTCGAGTCGCTGCTTCGAGTGTGACATCATCTGGTGTGACCACCAGGGGGCGGAGGAAGCATGCGGAAGCCCCGCCCCAAAAGTGCAGACCAGCCAAGGAGGCCAAAAGCTCCGCCTCTTCTGCATCTGGAGCCACACCCACTGGAGGAGGTGCCAAGGGAGAGGGGGAGGAGAAAGAGACGCTGGCGTGTGAAAAATG[C/A]CCGCGCGTGTTTAACACTCGCTGGTACCTGGAGAAGCACATGAACGTGACGCACAGGCGCATGCAGATCTGCGACAAGTGTGGGAAGAAGTTCGTGTTGGAGAGTGAGCTGGCTCTGCACCAGCAGACAGACTGCGAGAAGAATATTCAGGTAAAGAGCAGCTTCACAGGTGTCACATGATCTCAGACTGAAGTCAGAGGCCATAATTGTGGAAAGTTAGGATAGTATGTTATGGAAAGTCTACTTTTTTGGTACAAGAGATAACTAATTTTTTTTTTAATCTAAGACAGAAATAAAATTTAGGTAAAGCAAAATTAGGGCGGCAAGGTGGCTTAGTGGTTTGCATTGTTGCCTCACAGCTAGAATGTCACTGGTTCGAGTCCCGGCTGGGTCAGCTGGCGTTTCTGTGTGGAGTTTGCATGTTCTCCCCGTGTTGGCGTGGGTTTTCTCCAGGTGCTTCGGTTTCCCCCACAGTCCAAAGACATTCCCTATAGGTGAAT
Associated Phenotype:
Not determined