Busch Lab

ZMP

slc25a15b

Ensembl ID:
ENSDARG00000062271
ZFIN ID:
ZDB-GENE-060526-35
Description:
hypothetical protein LOC565335 [Source:RefSeq peptide;Acc:NP_001121816]
Human Orthologues:
SLC25A15, SLC25A2
Human Descriptions:
solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 [Source:HGNC Symbo
solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2 [Source:HGNC Symbol
Mouse Orthologues:
Slc25a15, Slc25a2
Mouse Descriptions:
solute carrier family 25 (mitochondrial carrier ornithine transporter), member 15 Gene [Source:MGI S
solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 2 Gene [Source:MGI Sy

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45199 Nonsense Mutation detected in F1 DNA Not yet available
sa18799 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45199
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089851 Nonsense 236 302 5 6
ENSDART00000136570 Nonsense 241 307 5 6
Genomic Location (Zv9):
Chromosome 5 (position 25830881)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23658146
GRCz11 5 24161946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTGGTGGAGCTTGTCTCTGGCTGGTGGTTTACCCAATGGACTGTGTT[A/T]AATCCAGGATACAGGTCATGTCGATGACAGGCAGACAATCAGGCTTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18799
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089851 Essential Splice Site 263 302 5 6
ENSDART00000136570 Essential Splice Site 268 307 5 6
Genomic Location (Zv9):
Chromosome 5 (position 25830964)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23658229
GRCz11 5 24162029
KASP Assay ID:
2259-5766.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACAATCAGGCTTCTTCAAGACTTTCATGCATATCTTCAGAACCGAAGG[T/A]AAGACAAAGATCTGAGCATTGATATTATGATTTACCCAATAACAATTGCT
Associated Phenotype:
Not determined