Busch Lab

ZMP

jarid2b

Ensembl ID:
ENSDARG00000062268
ZFIN ID:
ZDB-GENE-060503-246
Description:
Protein Jumonji [Source:UniProtKB/Swiss-Prot;Acc:Q1LVC2]
Human Orthologue:
JARID2
Human Description:
jumonji, AT rich interactive domain 2 [Source:HGNC Symbol;Acc:6196]
Mouse Orthologue:
Jarid2
Mouse Description:
jumonji, AT rich interactive domain 2 Gene [Source:MGI Symbol;Acc:MGI:104813]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa36845 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10625 Essential Splice Site Available for shipment Available now
sa9905 Nonsense Available for shipment Available now
sa36846 Nonsense Available for shipment Available now
sa39248 Nonsense Mutation detected in F1 DNA Not yet available
sa36847 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36845
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Essential Splice Site 15 1303 1 18
ENSDART00000147627 None None 1304 None 17
Genomic Location (Zv9):
Chromosome 19 (position 26457172)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26387284
GRCz11 19 25971507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAATGAGCAAGGAAAGACCTAAGAGGAATATCATTCAGAAGAAATACG[T/G]AAGTGTTGATCTTTCGTATGCGGCTGATCTTAAGTTTGTTCGATGGTCTT
Long Flanking Sequence:
GTGGTGCTGCTGGAGTTCACTCACTGTCTGCTAGCTCCAGCCAAAACGAACCCTTTTCCTTTTTTTTAAATTGTATTTATTTCATCCTACCATTGGATATGCCTTTTAAAAACAAGATGTAACTGGCCACCGAACAATTACATCCTCACTTGAATGAACCTACATGTTTTAAAGAGCCGGGATGAACATCACTGATGGAAGTTTATTGTGGCGAATGCTTTTAACTATGGTGTGCCGATGTGATTGTTTATTTTGCCCTCTATCCTTGGCGATGGGTCCCTAATTTTTGGGATTATTAATTCCGCGATTCTACAAGGAATCCTCGGCGATCGAAGAGGGAATTCTGCACAGCCAGGCAAACTACAGGGGATTTAAATCGGAGACGAGAAGAGAAGCAGGAAGAAAATTCATGTGGCGATTCTCTGCTTAACAATAAATCATTTTGGATTGCAGAATGAGCAAGGAAAGACCTAAGAGGAATATCATTCAGAAGAAATACG[T/G]AAGTGTTGATCTTTCGTATGCGGCTGATCTTAAGTTTGTTCGATGGTCTTTGTGTCGATGTGAAATGCGTAAACTTTGATCACGGATGGCTCTTGTTGTGCCAAGTCTGGCTTTGAAAACGAAATAAATGCATCACACTATGTTCACACCACTTCAATAGATTTAAAGGGCTTCCTCTGAAGTTCCAGGGACGCCTATTTTCTTTTGCTTTTACTCTGAAATCATCATTGGCGATGATTGTTTTGCACGACAGATGTAAGCTTGCAAAACTCGTTTGTAAACCTGGACGTGTTTTGTTTTGTTGTTGTTGGCAAACTCCAGTGTCAAATTAATGTTATTGTGATCAGAATGGCTTTGTTTGCTCTTCTATGCCTCAAGTCTCCAAGCGGCGAGGACAACCACATCGCCCTCTTTTATTCTGGGATCTGTTTTCACGAGCAGGATTCTGCAAAAAGACACAAGTCATAAAAACAACTGTCCCAACTCCCCTGGCATCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10625
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Essential Splice Site 100 1303 4 18
ENSDART00000147627 Essential Splice Site 85 1304 3 17
Genomic Location (Zv9):
Chromosome 19 (position 26597050)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26527162
GRCz11 19 26111385
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YAGAGGGCAAGTGTATTTAAAATCTATTGTTTNNTCTCTNTTTTTTTCTGTTC[A/T]GGCCCAGACTGCATGCACAGAGRARGTTTGCTCAGTCTCAACCCAACTCT
Long Flanking Sequence:
ATTGTGCTTCCATGAGGTAAAGTTTAGTCTGAATATTGCCAACATTCCACTATAACTGCATTATGAGAGTGCATGTAAAAAAGATGTTTGGGTGAACTATCTGTTTAAGATTGCATTTTTACATGTTATCAGTAGAAGATTAAACGTGTTAATAAAAAACAAAAAAAAAAAAAACAGTTTTTGTAGACTGTATCGTTTTAGTGCTCAATTCAGTGATCAACATTTAAATGATTATTATAAATAGCTGCTCTTGTCTGCTAATCAGACCAAAAACGTGTTTGAATTGGATCCAGATAGACAAAATTAGTCATGGCAACAGGCAGTGTAGTTTTAGCATCATGAGAACAAATGCACTAAGAGAAATTTGTTGCTCCGGGTATTACTTGAGTCCCAAAAGGATTAATACAATGCATTTAAGCAATGTATACATTAAGTATTTGTTATATAATATAGAGGGCAAGTGTATTTAAAATCTATTGTTTTCTCTTTTTTTTCTGTTC[A/T]GGCCCAGACTGCATGCACAGAGGAAGTTTGCTCAGTCTCAACCCAACTCTCCCAGCAACACACCAGTGAAGATGGCTGACCCCTCTCTGCCCACACCGCTCACACACATCACATTCCTCTCCAGACGCAAACCCAAGACAGAAGACTTCCTCACCTTCATATGCCTACGAGGTATTGCTTCGTTTTTCATTACCTTGCTAAACATTCAGAGTTGTGTTATAGAACAAATAATATTGTTATTAAATTTTTATTTTATTTTTTATTAGTTTTAATTTAAATTTGGTTTAATTTTTATTTTTTTATTTTTTTGTTCATTGAAATACATTTCTGGATGATTTTAGTCTCTATTGAACAGCACCACAGTATTCTTACTGTTATGGCAAACAGCAATGCACCATTTTGGTTCAAGTTGGGGACTTAACATGGCATAACACACTGGATTCTGTTTAATGTCTTATAAATGTGTCATTGCTCCTTAGTATAGCAATAAATTGCAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9905
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Nonsense 531 1303 7 18
ENSDART00000147627 Nonsense 516 1304 6 17
Genomic Location (Zv9):
Chromosome 19 (position 26623002)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26553114
GRCz11 19 26137337
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCAGCTTCCCCGTCCATGCCCCAGAACCCTGCAATCCCTGAGCCAGCA[C/T]GACAGCGACCCAAACGTGCCTCTGCTGGCAAACTGATGTTCATCAGAAAA
Long Flanking Sequence:
GCAATGGCCATGGCCGGCCCCAGCTCTCTCACTCAGGAAAAGCCCAAAGTATCAATGCAAAAACCCGCAAACAGGTGCTATTGTCGAATGGGGTGCATAAGATGACTAATGGGAGCCGGCTTAACGGCAGGCTAAATGGACGCCATAGTGCCAGGGAAGAAGAGGTTGTTGACCGACCAGTGCGGCAAGGACTGCGGAACTCTAAACGCAGAAGTGATGCCATGACATTGCTTGGAGCTGTAACTGAGAGTGAAGAGACTAAAACTAAGCAGCAAACCACTGAGGTTAAGAAAGCTAAAGTGCAGCCTAGCCCACTTGAAACTCGCAGCAAGAAAGCCCTGAATCAGTTCAAGTCCCCTAACATAGTCACTATTGCACATAGTATCACTGAAATGGCTGCCTCCCCTATTCAGAAAACGGGTCCTGCTCCTCCTCCATCTCCCCCTGCTGCTCCAGCTTCCCCGTCCATGCCCCAGAACCCTGCAATCCCTGAGCCAGCA[C/T]GACAGCGACCCAAACGTGCCTCTGCTGGCAAACTGATGTTCATCAGAAAAGCACAGCAGAGGGCCCAAACTAATCCTACCCTCAACCGGACCACATCCACTACCTCAGCCAGCAAGTCCTTCAAACCAGCAGAGCCCACACACACACCTCCACCTCGGCTGGACAGAGACAGGGAGCGTGAGAGGGAAAGGGAGAGAAGCAGGGCAAGGTATGCAGCCTTGGGGGATGTGCCCATTTTTAAGCCCAGCTCCAGGGAGTTCCAGGACCCTTTGGTGTACCTAGACTCATTTCGGGAACAGGTCGAGTCATGTGGACTGTGCAGAGTGCTGCCTCCTACTGACTGGAGGCCAGAGTGCAAACTCAATGATGAGATGCGTTTTGTGACACAGGTTCAGCGCATACACAAGCTGGGCAGGCGTTGGGGGCCCAATGTTCAAAAACTTGCCTGCATTAAGAAGCACCTCAAATCTCAGGGCATCTCAATGGATCAGCCACCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36846
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Nonsense 688 1303 7 18
ENSDART00000147627 Nonsense 673 1304 6 17
Genomic Location (Zv9):
Chromosome 19 (position 26623473)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26553585
GRCz11 19 26137808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGGGCCCAATGTTCAAAAACTTGCCTGCATTAAGAAGCACCTCAAATCT[C/T]AGGGCATCTCAATGGATCAGCCACCTGTTATAGGCAAGTCCTTTAAATCC
Long Flanking Sequence:
CCCAGAACCCTGCAATCCCTGAGCCAGCACGACAGCGACCCAAACGTGCCTCTGCTGGCAAACTGATGTTCATCAGAAAAGCACAGCAGAGGGCCCAAACTAATCCTACCCTCAACCGGACCACATCCACTACCTCAGCCAGCAAGTCCTTCAAACCAGCAGAGCCCACACACACACCTCCACCTCGGCTGGACAGAGACAGGGAGCGTGAGAGGGAAAGGGAGAGAAGCAGGGCAAGGTATGCAGCCTTGGGGGATGTGCCCATTTTTAAGCCCAGCTCCAGGGAGTTCCAGGACCCTTTGGTGTACCTAGACTCATTTCGGGAACAGGTCGAGTCATGTGGACTGTGCAGAGTGCTGCCTCCTACTGACTGGAGGCCAGAGTGCAAACTCAATGATGAGATGCGTTTTGTGACACAGGTTCAGCGCATACACAAGCTGGGCAGGCGTTGGGGGCCCAATGTTCAAAAACTTGCCTGCATTAAGAAGCACCTCAAATCT[C/T]AGGGCATCTCAATGGATCAGCCACCTGTTATAGGCAAGTCCTTTAAATCCTCTGCATTTAGATCTGCTTTTGTTTGTATAGGTCAAATCAGGACATGGAACACCACTGCACTGCAGAATTTAAGGCAGCCTCTCCTATGTATAATTTTCTAGCACCTAAAGCATTAGACCAGGGGTGTCTAAACTCGGACCTGAAGGGCCAGTGTCCTGCAGATTTTAGCTCCTACTTGCCTCAACATACCTGCAAGGATGTTTCCAGAAAGCCTTGTAAGAGCTTGATTAGCTAGCCCAGGTGTGTCTGATTGGGGTTGGAAGTAAACTTTGCAGGACACCGGCCATCCAGAACAGAGTTTGGGTACCCCTGCATTAGACACTATAGAGCACTGATACTACAAGGATAAGTTTGAGGGTCTAGAGTAAAGATGACCAAATATACTAGCAGCACTGCTTTGTAGTATTGTACCCTTGTCAAACATGTCTGAAAATCTTATCAGAATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39248
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Nonsense 701 1303 8 18
ENSDART00000147627 Nonsense 702 1304 7 17
Genomic Location (Zv9):
Chromosome 19 (position 26624827)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26554939
GRCz11 19 26139162
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCACAAGTTTAACAATCCCTTCTTCCATCTCACCCCTTCAGGTGGCTG[T/A]GAAGTAGATTTGGCTCGTTTTTCTGAGCTGGTCTGTGACTTGGGTGGAAT
Long Flanking Sequence:
TCAAATATTTTCCAGCATGATACAAGTTTAAACGAGCAGCCCCAAGCCTCAGAATTTTGTGTGCTATTTGAAGAACCGGTCATAAATTACAGTTGAAATAAATTTTTATTGAGTGAGTCAGAATGCCACCGTATTCTGTATCAATTCCTATGAGAGTTTTAAACTATTGGTCATTGAACTTTGCTGGCACTGACTTGCCCTCAGTCTTTAAACTCACTTTCTGCAGGTGTTATGTTTCATTGCTTCAAAAGACAAATAAAGATGCAACCCCAGATTACTCTAACATATTCAGAGAATTAATGAGCTGTGAAATGTAATGAATTTTAATTTTTGGAGCTGTCAATACCCATTTGGTGGCAGATGGTGCAGTCTGTCGTAGTTGCAGTGATTTCATTGGAGTTGTTTGGAAATGATATATTGTCTTTTATTACACCTTTCCTATCAAACTGTTTTCACAAGTTTAACAATCCCTTCTTCCATCTCACCCCTTCAGGTGGCTG[T/A]GAAGTAGATTTGGCTCGTTTTTCTGAGCTGGTCTGTGACTTGGGTGGAATGCAGCAGGTGATGGACCTGAAAAAATGGAGCCGGCTGGCCGATCTGCTTCGCATTCCCAAATCAGCACAGGATCGTCTGGCCAAGCTCCAGGAGGCCTACCTCCAGTTTCTGCTCTCTTATGACCTGCTTTCACCTGAGGAGCTCCAGCGTTTGGAGCAGGAGGTTCGAGCGGAAAAGGAGGCTCTGGAACGCAAGCGGGGACCCCTGGAGGGTCACTCTGATAACGGCCATCATTCTCTGGCTCTTCCTCGTTATGAACCCAAGAATGGGCTCAATGGCCTCAGCCATCGCAATGGCTTCCGCAATCACCACAAAGAGCCAGACATACAGCGGCAGGCTGGCCGCCGCAGACTGTTTGCTCAGGAAAAGAAAGGGGAAAAAGTGGAGTGTGAAGAGACAGAGGAGGAGATGGAAGATGAAGGTGTTCTCAGTGACCAGCACAAATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36847
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Essential Splice Site 1204 1303 16 18
ENSDART00000147627 Essential Splice Site 1205 1304 15 17
Genomic Location (Zv9):
Chromosome 19 (position 26634909)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26565021
GRCz11 19 26149244
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCAGAGAGGCGCTGCCAAATGTGCCAGCACCTCTGCTACTTATCTATG[G/A]TGAGATTATATCAGGTTATATTATCCTGCATTGCATACAAGGGTATTGAA
Long Flanking Sequence:
GCTTTAAAACGTGTGCTGCACATGGACATTTCTAGGCTATAGATGTTTATGTGCGTTTGCTGTTTTTTCACAGGACCTGAAATGCAGGCGCATAGCAAAACCCTTCTCTATGGAGAAGCTGCTGTATCAGATCGCCACAGCTGAGGCCAAACGAGAAAACAGACTTGTGCTCAGTACAATCTCTTCTCTTCTCAAAGATCTCAGGTGAGCATTGCCAGCCTGCCCACCAGTCAAATCATTACTGCAATAAACTTTCTTAACCATTACAGCCCTCTGTAAAGCAATTGTCAAGAGAGTGTGTGTTGATGTCCAACAGGAACATAGAGATGAAGCAAAGGCAGGAGCTGTATGAAGCAGGGCTGCTCTCCTCCGCACGCTACTGCACTCATGACCACAACCAATCACCTGCTGACACCAGGAAGAAGCCGCGCAAGTGGCTGGCACTGGAGTCATCAGAGAGGCGCTGCCAAATGTGCCAGCACCTCTGCTACTTATCTATG[G/A]TGAGATTATATCAGGTTATATTATCCTGCATTGCATACAAGGGTATTGAATTAGCATGGACGGAGGTGTCATGTCCTTAGCAATATCCACATATTACTGAATTGTCTCAACCAAAAATGTAATCCCCTCAAAAAAAAAAAAAAAAAAACATTTTAAAGAGCCCCTATTATACATTTAAAAGGGTCATATTTTGTTTTTAAGGTATCCAACAACAGGCTGATTTGCATGCAAAAGGTCTTATAATATGCAATTATTTTTACCTGATTATCCCAGTGACTCCCATTCGAGTTGTTCAGCGATTCATTTGTTCTCAAATCCCCCCTTAGCGCGAAGCTAATCTGCGCTGATTGGACAGATGACAACCTGTTGCGATTGGTCGACAGCGTTCAGCACGAGACAGAGTGAAATGCCCAGCACGTCTTATCAACAATATTGAAATAGCCACAGTGCATAGTGTATGTGTAAGCATACCTGCCAACAGTCCTGTTTTTCCCAAGAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3042
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Nonsense 1242 1303 18 18
ENSDART00000147627 Nonsense 1243 1304 17 17
Genomic Location (Zv9):
Chromosome 19 (position 26642008)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 26572120
GRCz11 19 26156343
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCAAAARTTTTAAACGTTTCTTCCCCATCTCTGTATGTCCCTGCAGGAA[C/T]AGATCAACAGTTTGGTGAATCAGGTGTGTGGTAAAGCRCTGGTGAGAAGC
Long Flanking Sequence:
ATGAGTTATTAAAAATATTATGTTTAGAAATGTGTTGAAACAATATTCTCTCCGTGAAACAGAAATTGTGGAAAAAAATAAACAGGGAGCTAATAATTCAGGGGGGCTAATGATTCTGACTTTAACTGTATATGCAACCCCTGTAGCAGATCTAAACACAGGTGGAACTGTGGTGGAGGAGGGTCTCAGCTTAACAGCGTAAAATGTGGAGCATTTGAACTAATGAGGAGCAAGCTCATTGGCTGCCGAGGTGACAGCAACCAATCTCCTGTGACATGTAGTTAATGATGCAGGGGCAGATTAGGTGAACCTATCAGCCTGCACATGCATAGAGTTTCATGGCAGAAATTTCACTTAGTTTAATTATATTTTCTGCAAGTAATGGTTTTTGAGTCGAGTATGAAGTCAAGTATGATTTTTTAGTACTGTTTTTACCACTGTATACAACCAGCCAAAAGTTTTAAACGTTTCTTCCCCATCTCTGTATGTCCCTGCAGGAA[C/T]AGATCAACAGTTTGGTGAATCAGGTGTGTGGTAAAGCACTGGTGAGAAGCGGGTCAGAAGTTTGTAATGGCTCCAGTCCCATTAAACCACCGGCCAAACGCGGCCCTCGCAAGAGGGAATCCATGAAGATTACTCTCATCCCTCTGCCAACCCACCCATCCAAAAGTGCCGCTGCTGCCGTCTCATGATAAACGCCGCCCTGTTGCCCAAATCAACCGATCATTTTCCTTTCTTCATATCGTTTGTCTTTTATCACCCACCTAGCAGGGCAGATATATCTGTGTTGAAAGCAGGCTGCCTTTTTTTGCACTAGCGCACTAGTTTTGAATTCACCAGATGTTTGATAGCATTAAGAGACACTGTCCCAGGTGTTTCACTGACAGGTGTGAGTATGATGTCACCATGTTCGTCCTCCTCTTCAGCCCCATCGACTGCACACAAACACACAAGCTCCACCTGAACTGTGAACTGTGGGACAAATGGGTGCTTTTTTCCCTGTT
Associated Phenotype:
Not determined