Busch Lab

ZMP

zgc:85942

Ensembl ID:
ENSDARG00000062262
ZFIN ID:
ZDB-GENE-040426-2364
Description:
hypothetical protein LOC405866 [Source:RefSeq peptide;Acc:NP_998095]
Human Orthologue:
EDNRA
Human Description:
endothelin receptor type A [Source:HGNC Symbol;Acc:3179]
Mouse Orthologue:
Ednra
Mouse Description:
endothelin receptor type A Gene [Source:MGI Symbol;Acc:MGI:105923]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44063 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16023 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44063
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089837 Essential Splice Site 208 328 None 6
ENSDART00000089841 Essential Splice Site 278 363 None 8
ENSDART00000111996 Essential Splice Site 278 363 None 8
Genomic Location (Zv9):
Chromosome 23 (position 46049720)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45964546
GRCz11 23 45699741
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGTGTGTGTTTTTTATATAAATGTGTGTGTGTGTGTGTGTGTGTGTGT[A/G]GAGGCGGGAGGTGGCCAAAGCCGTGTTCTCTCTGGTGCTGATCTTCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16023
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089837 Essential Splice Site 289 328 None 6
ENSDART00000089841 Essential Splice Site 311 363 None 8
ENSDART00000111996 Essential Splice Site 311 363 None 8
Genomic Location (Zv9):
Chromosome 23 (position 46054903)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45959363
GRCz11 23 45694558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTGTGTGTGTGTGTGNNTCATCTCATGTGTGTGTGGTCTCTCCTC[A/T]GTCGTGTCTGTGCTGCTGGTGTTACTCAGACRGGTCTCTGATGGGCAGYG
Associated Phenotype:
Not determined