Busch Lab

ZMP

FAT3 (2 of 4)

Ensembl ID:
ENSDARG00000062246
Description:
FAT tumor suppressor homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:23112]
Human Orthologue:
FAT3
Human Description:
FAT tumor suppressor homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:23112]
Mouse Orthologue:
Fat3
Mouse Description:
FAT tumor suppressor homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2444314]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15618 Nonsense Available for shipment Available now
sa12567 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15618
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089789 Nonsense 163 268 3 4
Genomic Location (Zv9):
Chromosome 10 (position 25787909)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25191841
GRCz11 10 25163268
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTCCAAGATGAAAATGACAACACTCCWGAATTCAAAGAGTCTATTTAT[C/T]GAATCAGCYTTCCAGAGCGGGATCGAAACAAACGCGGAGACCCAGTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12567
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089789 Nonsense 163 268 3 4
Genomic Location (Zv9):
Chromosome 10 (position 25787909)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25191841
GRCz11 10 25163268
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTCCAAGATGAAAATGACAACACTCCWGAATTCAAAGAGTCTATTTAT[C/T]GAATCAGCYTTCCAGAGCGGGATCGAAACAAACGCGGAGACCCAGTCTAC
Associated Phenotype:
Not determined