Busch Lab

ZMP

plekha7b

Ensembl ID:
ENSDARG00000062220
ZFIN ID:
ZDB-GENE-091014-2
Human Orthologue:
PLEKHA7
Human Description:
pleckstrin homology domain containing, family A member 7 [Source:HGNC Symbol;Acc:27049]
Mouse Orthologue:
Plekha7
Mouse Description:
pleckstrin homology domain containing, family A member 7 Gene [Source:MGI Symbol;Acc:MGI:2445094]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa11681 Nonsense Available for shipment Available now
sa18677 Nonsense Available for shipment Available now
sa11132 Nonsense Available for shipment Available now
sa31573 Nonsense Available for shipment Available now
sa18155 Nonsense Available for shipment Available now
sa40897 Nonsense Mutation detected in F1 DNA Not yet available
sa20950 Nonsense Available for shipment Available now
sa9044 Nonsense Mutation detected in F1 DNA Not yet available
sa34078 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11681
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 188 1267 7 27
ENSDART00000110605 Nonsense 188 1267 7 27
Genomic Location (Zv9):
Chromosome 7 (position 28282325)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26885264
GRCz11 7 27156457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCTTAGGACAGCTCAGGCATGAGACTGTGGAAGAGGAAATGGTTTGTGT[T/A]GTCTGATTACTGCTTGTTTTATTATAAAGGTGAGTTATTGGATTCTACTT
Long Flanking Sequence:
ATCAAAAGGAACCCCAATGTCCCGGTGGTGGTGAGAGGATGGCTCTACAAACAGGTGCGAGTCTCAAAAGTAGATTACAGAGTTTGATTTTGATCTAAACTAAATGGTGCTCAGATGTTAGATTACATCTTAAATACGGCAGGCCTTATGACAAACTAAGACCCACAGTCACAGTAAACTGATTGATAGTTTTATTTAACATATATTAAACACATATTCTGTATGAAGGAGGAATTCATTTAAATGCAGCATACTGTATATTGGTTTGTAATAACAGATAGTGCCCTGACTGTTTTTAAATAATTATGAATGGGTCATTTAAAGTTGATGATTAGCGTAACAAAACATTTGCTACTAAATGTACCTTGTTATCTTATAATGTAGTTTATTAGATTATGCATACAGTTGAAACTGATAAATACTGTGAATTGAAATGTTATACTTCATCCACCCTTAGGACAGCTCAGGCATGAGACTGTGGAAGAGGAAATGGTTTGTGT[T/A]GTCTGATTACTGCTTGTTTTATTATAAAGGTGAGTTATTGGATTCTACTTAAATTAGCTGTAATTATCTAAAACAGGTCTCTAATTTTATTGCCTCATAATCACTTTTTTCATAAGTAAATCACTCTGTTTATGTAACACATTATTATGAGTGCCTATAATAAATGTTAATAGCAGATTTATATACTAAATAGCATTAAACAGTTTTGTTTTTAACATTGTTTATGTTAAGTAATGCATTATTTTTTATATAATTTCATCAGAAAAATTGGAATATCACTTGCTTACTGCCATTTGTTTCTGTTTAAGAATGAATTAATTGCATCATTTTTCAGCTGTAACTAACCATTTTCAGGCTTTTTCTTATAACATCTGTCCTTTATTCACAGATAGTCGAGAGGAGACTGTTTTGGGCAGTATACCTCTGCCCAGCTATGTAATTTCTCCCGTGGGACCCGAGGATCACATCAGCCGCAAGTATGCCTTCAAGGTAAGAGCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18677
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 188 1267 7 27
ENSDART00000110605 Nonsense 188 1267 7 27
Genomic Location (Zv9):
Chromosome 7 (position 28282325)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26885264
GRCz11 7 27156457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCTTAGGACAGCTCAGGCATGAGACTGTGGAAGAGGAAATGGTTTGTGT[T/A]GTCTGATTACTGCTTGTTTTATTATAAAGGTGAGTTATTGGATTCTACTT
Long Flanking Sequence:
ATCAAAAGGAACCCCAATGTCCCGGTGGTGGTGAGAGGATGGCTCTACAAACAGGTGCGAGTCTCAAAAGTAGATTACAGAGTTTGATTTTGATCTAAACTAAATGGTGCTCAGATGTTAGATTACATCTTAAATACGGCAGGCCTTATGACAAACTAAGACCCACAGTCACAGTAAACTGATTGATAGTTTTATTTAACATATATTAAACACATATTCTGTATGAAGGAGGAATTCATTTAAATGCAGCATACTGTATATTGGTTTGTAATAACAGATAGTGCCCTGACTGTTTTTAAATAATTATGAATGGGTCATTTAAAGTTGATGATTAGCGTAACAAAACATTTGCTACTAAATGTACCTTGTTATCTTATAATGTAGTTTATTAGATTATGCATACAGTTGAAACTGATAAATACTGTGAATTGAAATGTTATACTTCATCCACCCTTAGGACAGCTCAGGCATGAGACTGTGGAAGAGGAAATGGTTTGTGT[T/A]GTCTGATTACTGCTTGTTTTATTATAAAGGTGAGTTATTGGATTCTACTTAAATTAGCTGTAATTATCTAAAACAGGTCTCTAATTTTATTGCCTCATAATCACTTTTTTCATAAGTAAATCACTCTGTTTATGTAACACATTATTATGAGTGCCTATAATAAATGTTAATAGCAGATTTATATACTAAATAGCATTAAACAGTTTTGTTTTTAACATTGTTTATGTTAAGTAATGCATTATTTTTTATATAATTTCATCAGAAAAATTGGAATATCACTTGCTTACTGCCATTTGTTTCTGTTTAAGAATGAATTAATTGCATCATTTTTCAGCTGTAACTAACCATTTTCAGGCTTTTTCTTATAACATCTGTCCTTTATTCACAGATAGTCGAGAGGAGACTGTTTTGGGCAGTATACCTCTGCCCAGCTATGTAATTTCTCCCGTGGGACCCGAGGATCACATCAGCCGCAAGTATGCCTTCAAGGTAAGAGCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11132
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 300 1267 10 27
Genomic Location (Zv9):
Chromosome 7 (position 28305082)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26908021
GRCz11 7 27179214
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAACTCWCTTTTWCTCCACAGAGAAGCTGAAAGAAGCTCCAAACCTGAG[C/T]AGCATGCCGTCCCACAGACCAACCATTTCAGCAGCAKCAAAGGCTCATCC
Long Flanking Sequence:
TAAGGTCTGATTTAATCAGAGTAAATTGTACTCTTTCATTATGTATGTATTGTGCTTTTTATGCAGAAAAAAGTCATTCAGGCTTTGTCTTGTTGCGTTTAGAATGGAAATAGCTTTCATGAGGTAGGCCATCAGCACAAGGTCAGATAATTGTACATTGGGACTGTAGACTCAAAATTAATGCAGTCTAAACTCATTTCTGTCGTGTTTTGCTTCTTTGTGCCGAAAGAAACACTTAAAAAATGCTTAATTGTCATTGATGTTTACATAAAGTCTTTTCATTGCCTATAAAAAATTTCTTTATAGTGGGTAAGGTTCTTCAGGTCATTGAAAATGCTTTTTATTCTAAGAAAAATGGTTCATTTAAGAACTGTTCGCTGAATGGTTTTTTAGAACGCTTGTTTTTTTTAAGAGTGAAGGTCAAATATATATTTGTGTTCTGACTTTTAAATAACTCTCTTTTTCTCCACAGAGAAGCTGAAAGAAGCTCCAAACCTGAG[C/T]AGCATGCCGTCCCACAGACCAACCATTTCAGCAGCATCAAAGGCTCATCCCAGGCAGAGAGCGCCCAGCAAACACATATAGAGGTGGCGGAGCTGAGACCGCAGCGAGATGGAGACGAGTGTTACGTTTACAGCAAGGATATAACCGAGGATCCTGTTAAACTCATGTCCCCTGGAGAAATGGAGATGGAGGCGCTTTCCCAATCAGGTGCTCATTCACGGCCTCCGTCCACGGTGCCCACTCAAAGGAACGGACTGCCCTCTTCAGGCATTCCTCCTGATCAGAACGGCAACGTAGTGTATAAGAGAGGTCTCGTCCCACGTACAGACACTGAGAAAAAGGTACAGAGAAAAACTGCGCTTGCTCAGGTCGAGCACTGGGTGAAAGTACAGAAAGGAGACCCCAAAAGGTCAGTTTTTTTTGGATAATGTAAACACCTTTAAATATGCTGCGGTTGAGTAAAAAATACTTGGAATACATAAAGGTATTTTTGTAATACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2412
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 487 1267 11 27
Genomic Location (Zv9):
Chromosome 7 (position 28307851)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26910790
GRCz11 7 27181983
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTCYGGAAGCAGTTCTCCCCCTGTGCCGCGCAACCTGCCCAGTGACTA[T/A]AAGTACGCCCATGACCGTCTTAGTCACTTCCGCATGTCCACCGATGAGCG
Long Flanking Sequence:
TAAAATAATAAATAAAGTGTTATATTTAAAGTTTATATCATAAAATAAATATACAATTATCGTAGTTGAATTTATTGCATATAAACTTATATTATTTATTATATTAATAATGTAGTACTAAAGTATGCAGTTATTTTATTTTATTAGTGCACTACCAAAAATAATAATTAAAAAACACTTAAAGTTTATGTAATAAAATAATTCAATACACAATAGTAAAATAAAATGTACAATAAAATAACACTTCTTAAAACATATAAAAGTGTATGAATTTTTTTCCTATAAGTAATATGTAATTGACAATGAGATTTGAGTGTGTATTAACAGTTAAAACCTTGACATTCCAGCCATCCCACTGCTGAGTACACTCTACCCAGACGGACGCCTCCACTCCAGCCCAAGTCCGTCATGATGGACACATACCAGTCGTTGCCAAAGACCACGCGCCACCACTCCGGAAGCAGTTCTCCCCCTGTGCCGCGCAACCTGCCCAGTGACTA[T/A]AAGTACGCCCATGACCGTCTTAGTCACTTCCGCATGTCCACCGATGAGCGCATGGCCACTAAAGAGGGCATGGTGTGGCAGCTATATGAGTGGCAACAGCGGCAACAGTTCCGCCACGGAAGCCCGACAGCGCCCATCTACACCGGGCCTGATTACATGGACACCTCCGCCTTTAGGGTCACTCTGGAAATGCCACGATCCATATCCGTGCCCCCATCGCCATGTGACATGCCTCCATCAGGGCACCCCTCGAAATCCCTTTCCCCACGCAGGCCTCATACGCCCGCAGACAGGGTGACGGTACGCCCGCTGGACGACTTTGCCACCGTGGATACACCCATTTTGGGTTCTCCCAGAGGAATATGTTCCCAGATCTCAAAGGTAGGGAATGCGGAGCAGTTTCACATCTTTTAAATTAGTTGTGGTGAGCTCCTCTTTTTGTTGAGACCACAGGAGCGTTGACCACCAAAGGCATGAAGGGTTATGGGAAAACCGACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31573
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 802 1267 18 27
Genomic Location (Zv9):
Chromosome 7 (position 28332022)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26934961
GRCz11 7 27206154
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAAACGTAAATCTGTGTTTGTGTGCAGCAGGAGAAATCTCAAATGAGG[A/T]AGGAACTGTGGCGGATCGAAGATGTGCTCGCAGGCCTGAGCTCAAGCAAA
Long Flanking Sequence:
CGAACCAATATCCAATCCAAGTACTGTGATCGGTGCATCCCTAATACACACACCGCTGTTTGACACTATTCTCTCCACCTATCGAGTCAATGAAGGACCAAAGATGCCTGCATTGTGAAAAGTGGAGGGTTTTTCCCATATGGCGTCCATTAAAACAACACTCTTCCAGCAGTTCATACTCGCATCCAATATCTTGTTTGTCACAGGGAGAATGCATTAAATGTTCCTGAATGAAAGTGTAAGTCTCAAACTGCTGTTAAAGTCAACAAATAAAAATGAAACACCCTAAATTATATGCTAAATGTGGATAGCATGGTGACACAATGATGTTAATTGAATTATGTGCTATTACATAAAAAATGGGATCATGAAAAGCAACTCATGTAAACACCTTAATCGTATTATTGTCCTTATTTAGATTAAGGCAAATAATTCAATCAATGATGTCCATGCAAACGTAAATCTGTGTTTGTGTGCAGCAGGAGAAATCTCAAATGAGG[A/T]AGGAACTGTGGCGGATCGAAGATGTGCTCGCAGGCCTGAGCTCAAGCAAAGCAAACTACAGAGTGATCATTGACTCAGTGCGTAATCCAGGTGAGAGCGGCCCCCTTCCTGCCATCACCCCCATGCACTGGAACACAGCCAGAGGTATTGAGGCCAAACGTCATCACATGCGACCCCACATACAGATCATACTGATAATAATACCTGTGTTTTTGTTTTTGTAAACATTTGGGATGTTTGTGTGACCCAGAGAGGAAACTCGTGCCTTCAGCGTCATTGTCCGCAGTGCCTTCGCTCTCCGACAGCCCGTCCATGGGGGAACTAAAAGCTGCTCAACCCAGCCCACATCTCAGCCCTGTGCAGCCATGTACCCAACAGCCTCTGCAACTCTCGCACACAGCCCTCAAGCCAAAATGGGTAAGTTATTGGGTGAAATTGAATAACCAGCAGTGATGCACTGATCTTGAATTTTACAGTGAAATTAACTAATTCTGATACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18155
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 821 1267 18 27
Genomic Location (Zv9):
Chromosome 7 (position 28332081)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26935020
GRCz11 7 27206213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGYGGATCGAAGATGTGCTCGCAGGCCTGAGCTCAAGCAAAGCAAACTA[C/A]AGAGTGAKCATTGACTCAGTGCGTAATCCAGGTGAGAGCGGCYCCCTTCC
Long Flanking Sequence:
TTGACACTATTCTCTCCACCTATCGAGTCAATGAAGGACCAAAGATGCCTGCATTGTGAAAAGTGGAGGGTTTTTCCCATATGGCGTCCATTAAAACAACACTCTTCCAGCAGTTCATACTCGCATCCAATATCTTGTTTGTCACAGGGAGAATGCATTAAATGTTCCTGAATGAAAGTGTAAGTCTCAAACTGCTGTTAAAGTCAACAAATAAAAATGAAACACCCTAAATTATATGCTAAATGTGGATAGCATGGTGACACAATGATGTTAATTGAATTATGTGCTATTACATAAAAAATGGGATCATGAAAAGCAACTCATGTAAACACCTTAATCGTATTATTGTCCTTATTTAGATTAAGGCAAATAATTCAATCAATGATGTCCATGCAAACGTAAATCTGTGTTTGTGTGCAGCAGGAGAAATCTCAAATGAGGAAGGAACTGTGGCGGATCGAAGATGTGCTCGCAGGCCTGAGCTCAAGCAAAGCAAACTA[C/A]AGAGTGATCATTGACTCAGTGCGTAATCCAGGTGAGAGCGGCCCCCTTCCTGCCATCACCCCCATGCACTGGAACACAGCCAGAGGTATTGAGGCCAAACGTCATCACATGCGACCCCACATACAGATCATACTGATAATAATACCTGTGTTTTTGTTTTTGTAAACATTTGGGATGTTTGTGTGACCCAGAGAGGAAACTCGTGCCTTCAGCGTCATTGTCCGCAGTGCCTTCGCTCTCCGACAGCCCGTCCATGGGGGAACTAAAAGCTGCTCAACCCAGCCCACATCTCAGCCCTGTGCAGCCATGTACCCAACAGCCTCTGCAACTCTCGCACACAGCCCTCAAGCCAAAATGGGTAAGTTATTGGGTGAAATTGAATAACCAGCAGTGATGCACTGATCTTGAATTTTACAGTGAAATTAACTAATTCTGATACTGATGAATGAAAAACTTTACATGAAAAATTTACTTAAAATAAAACTATTAACTCTCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40897
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 892 1267 19 27
Genomic Location (Zv9):
Chromosome 7 (position 28332398)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26935337
GRCz11 7 27206530
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCTGCTCAACCCAGCCCACATCTCAGCCCTGTGCAGCCATGTACCCAA[C/T]AGCCTCTGCAACTCTCGCACACAGCCCTCAAGCCAAAATGGGTAAGTTAT
Long Flanking Sequence:
AACTCATGTAAACACCTTAATCGTATTATTGTCCTTATTTAGATTAAGGCAAATAATTCAATCAATGATGTCCATGCAAACGTAAATCTGTGTTTGTGTGCAGCAGGAGAAATCTCAAATGAGGAAGGAACTGTGGCGGATCGAAGATGTGCTCGCAGGCCTGAGCTCAAGCAAAGCAAACTACAGAGTGATCATTGACTCAGTGCGTAATCCAGGTGAGAGCGGCCCCCTTCCTGCCATCACCCCCATGCACTGGAACACAGCCAGAGGTATTGAGGCCAAACGTCATCACATGCGACCCCACATACAGATCATACTGATAATAATACCTGTGTTTTTGTTTTTGTAAACATTTGGGATGTTTGTGTGACCCAGAGAGGAAACTCGTGCCTTCAGCGTCATTGTCCGCAGTGCCTTCGCTCTCCGACAGCCCGTCCATGGGGGAACTAAAAGCTGCTCAACCCAGCCCACATCTCAGCCCTGTGCAGCCATGTACCCAA[C/T]AGCCTCTGCAACTCTCGCACACAGCCCTCAAGCCAAAATGGGTAAGTTATTGGGTGAAATTGAATAACCAGCAGTGATGCACTGATCTTGAATTTTACAGTGAAATTAACTAATTCTGATACTGATGAATGAAAAACTTTACATGAAAAATTTACTTAAAATAAAACTATTAACTCTCTTTCAGTAGGTGGCTGAATTCCTTGGTTAGTGCTGTAAACAAAAAAAGCTGTGCTGTTATTTTCAAATAAATATCAAAATAAGATATCATCTTAAATTTTCTGAAGACAGAGAATCTACCCTGTTGATACTTCAGTGTGTCTGCTGGCTTTTAAAAAGTCTTAAAATGTCTCAAATATCAAAATAAAAAATTTAGGCCTTAAAAGGCTTAAATTGACTGAAATATTGTGTTTTAGGTCTTAAGTCTTTTTAACACAGGCCTTCATTTAAGAAAAAAATATTTTTTTCACATTTTTCGAGTGCCTTGGACTGATTTTTGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20950
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 987 1267 21 27
Genomic Location (Zv9):
Chromosome 7 (position 28334731)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26937670
GRCz11 7 27208863
KASP Assay ID:
2259-8883.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAGATACGGGCATTCCTCAGCGAGCCTGAACTGCTGGTGGTCGGTGGA[C/T]AGATTGGGAGCTTGAGCCGTGATAGTGGCTACCAAACTCTACCAAACAGA
Long Flanking Sequence:
CAAACATGTCCTCTCTCCATATTTTCTCAACTTTCAGCATCCCTCTGTTACTCCAGCCCCACACCTTTAAACATGATTCCTACTTAAATCGGAGCAAGGGAAGCATTATGTAACCAAATGCCACTTCAGTCCATTTATCTAAACTTATAGATGTTTTATCTGTATGTATTCAGCCTGAAGAAGATGCTCCTCCCAGACCGCCTCTCCCTCACCTCTACAGCCCAGACGAACACCCTCCAGCTGTGCCCCCTCTGCCCAAAGAGACCTCTGTCATCCGACACACTTCAGTTCGGGGTCTGAAACGGCAGTCTGATGAGCGCAAGCGCGATCGTGAAATCGGACAGTTCTCTAACGGAGATCACAAGGTTTGTGCCAAGCTGAACAGTACCAAGATAAAGCCACATTTCAATGTTAATTGAGTCCTGAGATCTTTTTTCCTGGAAATCTAGGTTGAGATACGGGCATTCCTCAGCGAGCCTGAACTGCTGGTGGTCGGTGGA[C/T]AGATTGGGAGCTTGAGCCGTGATAGTGGCTACCAAACTCTACCAAACAGAGGTACACACATGATAGAATATATATATGTACACTAATTGGAGCTTGGTTAATGCAAACCACTGCCTGATTCAATGGTAATGTGAAAACATGCAAGTAAATAGTTGATTATTATGTGTACTTAATTATTGTATTCCTAAATGAAGCAGAAATTTTGACTAATTTTTCAAGTTTGAAAGTTGTTGTTAAATGTGTGTAGCTTAGACCAGGGGTTTCCCAAACTTTTCAGCCTGCAACCCTTTAAAAAATAATGCCAGTGACTTGTGAACCCCAACATTCTGGTGGTGGTTATAAATATACAATCCTTACAAATAAAGGTGCACAAACACCAATTCTATTCTTGGTGTAATTTTGGCGACCGCCACTCGGAGACCATCCTTCATGTTCAGTAGTGGCCTGTATTTATTTTTAATGTACGTGATTCAATTCAATTCAATTCAATTAATCTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9044
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 1015 1267 22 27
Genomic Location (Zv9):
Chromosome 7 (position 28336119)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26939058
GRCz11 7 27210251
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTCCAATTCTGCTAGGTTTGACAAGCTCCTCTTCAAGACTGAACCAGT[C/G]ATCAAACATTTCATCATTTGTCACCCTCAGAAGAGGACTCACCACCACAA
Long Flanking Sequence:
AATGGCAGAATGCTGTTAAACACATTTTGTCATTTGAGACTTATGGAAATGTAATGAATGTTTTCATGATTTTTTTTTTTAGAAAAATTATAATTTTGTGCATTATCACATTCTACAACAGTTTCAGACAGGTTGAATTTTTGTCAAGATATTGGTACTTTCATTTTGTACTGATGCATTAAATTGATTAAAAATAACAGTAAAGGCATTCAATGACACAAGCACAACTTACCAGTTTAAATAATGACTGCCAAAAACGGACTTGCCTTCAAAAAGATAAATAAATGAATAAAAAAAGTTGAAGTAGTTATTTAAATAAATACTATTATTTAATTCAAAAATCTTTGTGATAAAACAGTGCAGTCTTGTCATACATTTCTGACTCAGTGAGCACAATAAAGATGGACAATTATAGAAGTATTTTAGCAGGTCTGAAACATTTGCCTAATCCAGTCCAATTCTGCTAGGTTTGACAAGCTCCTCTTCAAGACTGAACCAGT[C/G]ATCAAACATTTCATCATTTGTCACCCTCAGAAGAGGACTCACCACCACAAGCTTGAAGGTAGGACGTCAAACAAGTCCCAGAGATGTCTATTGGGAGGCAGAGGGACATAAAGAGTCTGTCATGGTTTGCTTTGGCGGAGTCGATGAGATACAGCAGCAGTGCAAACCGCTGAGCGCATGAAATAAAAGCAGCCAGTGTGGGTTTGAGCACGACTGTACTTTTTGCGAATAAATTACTGTGGTAGTGTTGCCATGCAGAGTGAACACAGTGTGTGTCTCCCACCCTGATGGATTCATGTAGAAATTGTTAACACAAATAAGCATAGCGGCTTCAAAATGCACTCCTGAAACTTTCCTCTCTTCCCTGTCTCTTGCCAACTGACAATTTTACATGCATTTAAAACAGCACACTTTAATAAAAATGTATATGCAGACAGATACGGAAAAATTTGCGACCATTTGATTCTAATGTTACAATCTTTGTATTTACAATCTTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34078
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 1077 1267 23 27
Genomic Location (Zv9):
Chromosome 7 (position 28338599)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26941538
GRCz11 7 27212731
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCTGGAGAGGATGAAGCGCCACCAAAAGGCTCTGGTACGAGAGCGC[A/T]AGAGAACCCTCAGCCAGGGCGAGCGGCAGGCCTCCACGTCTCGCGCTTCT
Long Flanking Sequence:
GCATGCCAAACAAGCTTTATAGTTAATCATCAGCTAAGTGTGAACTCTTAAAGTGCCCTTGATAGAGTGCACAGTTTAATTAATGCAGAAAGGTACCTTAGTGCTGGTCCATGTAGGGATTTAAAAAGTAAAACTAAAATCTTAAAACGTACTCTAAAAATGAACAGGAAGCCAGTAAAGAGAAACACACAAAAAAAGGTAAAAAACAAATTTTAGCACAACATGAAATTAATAAAAAAATGACTCTACATTCTTCTCCACATCTTCAATTTGGCATACAATATTGCTCCCGTTTCAGCACATTCTCTCTATCCGTGCTGTTCTTTAGCGCAGTTCATTCTGGCAATATTAACTCATCCTTCGATGTCTCCTAGGAGAGACCAAAGAGTGCCTTGGAGCGTCTTTACTCCGGAGAGCCTGTGCAGCAGCGCGGACGCATGAGCGCAGAAGAGCAGCTGGAGAGGATGAAGCGCCACCAAAAGGCTCTGGTACGAGAGCGC[A/T]AGAGAACCCTCAGCCAGGGCGAGCGGCAGGCCTCCACGTCTCGCGCTTCTTCCTCCTCCACCTCCAGACCCGTCTCTGCAGACCTGGGATCAGTACGTTAAGAGCACAATGACACATTTGATCCTCCAGAGAGGACCGTCACCCTGACGTTAATGCACGTTCAGCTATTTACACTGTTTTGATGGAGAACTGTAAGATTTGGTGTTAAAGCGATCAGCGTTTTTAATGAGGTAGCGTTTGCCGCAGGTAAGTGTGTTTGCGGGAGGTGTTGCAGAAGGAGATGGGAGAGATTTTTTTATCATATGTTGTTGAGCCACATGGATAGGCTTTGGGATAAGAACAGACAGAATGCTATTTGCCAATGAAAGACTTATTATTATGTGTTTAGAGGAGTATTAATGAAAGTTGATGTGCTGTTCATTCTTATTACACTCTGAGGATGGTTCAAAATGTTCAAATGACATGTAGGAGTGTTTAATTTTAACCATCTCTTCTGGTAT
Associated Phenotype:
Not determined