Busch Lab

ZMP

FBXO31

Ensembl ID:
ENSDARG00000062195
Description:
F-box protein 31 [Source:HGNC Symbol;Acc:16510]
Human Orthologue:
FBXO31
Human Description:
F-box protein 31 [Source:HGNC Symbol;Acc:16510]
Mouse Orthologue:
Fbxo31
Mouse Description:
F-box protein 31 Gene [Source:MGI Symbol;Acc:MGI:1354708]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45853 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1009 Essential Splice Site Available for shipment Available now
sa11947 Essential Splice Site Available for shipment Available now
sa19363 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45853
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089642 Essential Splice Site 190 542 3 9
Genomic Location (Zv9):
Chromosome 25 (position 22548063)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21779939
GRCz11 25 21877487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTCTGGCAGCCTGATATCGGGCCCTATGGAGGACTGCTGAATGTGGTG[G/A]TAAGATCACAAAACAATAACACAATTTAATTAGAATTTAAATACAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1009
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089642 Essential Splice Site 190 542 3 9
Genomic Location (Zv9):
Chromosome 25 (position 22548062)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21779938
GRCz11 25 21877486
KASP Assay ID:
554-0913.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCTGGCAGCCTGATATCGGGCCCTATGGAGGACTGCTGAATGTGGTGG[T/G]AAGATCACAAAACAATAACACAATTTAATTAGAATTTAAATRCAAGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11947
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089642 Essential Splice Site 271 542 5 9
ENSDART00000089642 Essential Splice Site 271 542 5 9
Genomic Location (Zv9):
Chromosome 25 (position 22537095)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21768971
GRCz11 25 21866519
KASP Assay ID:
554-6230.1 (used for ordering genotyping assays)
KASP Sequence:
CAAGTGCAACCAGACCGATCACCATCGAATGCCTGGAGGAAGGCAAGAGG[T/G]AAGAGAGCAGYGATGCYTGCACAGATTTTAANGGAATACTATGGCAGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19363
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089642 Essential Splice Site 271 542 5 9
ENSDART00000089642 Essential Splice Site 271 542 5 9
Genomic Location (Zv9):
Chromosome 25 (position 22537095)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21768971
GRCz11 25 21866519
KASP Assay ID:
554-6230.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTGCAACCAGACCGATCACCATCGAATGCCTGGAGGAAGGCAAGAGG[T/G]AAGAGAGCAGTGATGCTTGCACAGATTTTAAGGAATACTATGGCAGAATT
Associated Phenotype:
Not determined