Busch Lab

ZMP

dcbld2

Ensembl ID:
ENSDARG00000062177
ZFIN ID:
ZDB-GENE-070112-1822
Description:
discoidin, CUB and LCCL domain containing 2 [Source:RefSeq peptide;Acc:NP_001073640]
Human Orthologue:
DCBLD2
Human Description:
discoidin, CUB and LCCL domain containing 2 [Source:HGNC Symbol;Acc:24627]
Mouse Orthologue:
Dcbld2
Mouse Description:
discoidin, CUB and LCCL domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1920629]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa21503 Nonsense Available for shipment Available now
sa41444 Nonsense Mutation detected in F1 DNA Not yet available
sa8562 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27415
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089582 Nonsense 107 235 2 9
ENSDART00000113710 Nonsense 107 671 2 15
ENSDART00000139863 Nonsense 107 661 2 15
ENSDART00000140040 None None 42 3 9
Genomic Location (Zv9):
Chromosome 9 (position 31081523)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30237469
GRCz11 9 30048215
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAATTGCCAGGTGTCTTACCTGCGACTCTATAATGGGATCGGACCGGGA[C/T]GAACAGAAATTGGTGAGAAACAGTAATGAACTTTATGTTCTTTTTGCATC
Long Flanking Sequence:
ATGTTATGCTTCATTAAATACCAGCTTGTAATAACACCTGTAATGAACTTTTGTGATTAAATTTATAATTACACTGTTGACCATACACTTTTCATCTCAATCCACCCTTAAACCTACCTATACCACCAAACCTGCCCTAACCCTACCTTTATCCCATCTCAAGAGCACCTGAATATATATTTTTGATGTAAGTACATAGTAGTTGAGGCCACTTAATATGAAGTGGGACCAAATATTCCATGATGTTGAGCTCTGCAGAGTTTTTGATGTTTTCTGGGTGTTTTTCAGGGGACGGCTGTGGACACACAGTGTTAGGTGTGGGCAGCGGGAGCCTGGCGTCTCTGGGTTATCCTCAGTCTTATCCTTCACAGTCTGTGTGTGAGTGGGAGATCAGCGTGACCGCTGGGCACAAAGTCCTTGTGCGCATCGCAGATCTTGACATTGATACAAACAATTGCCAGGTGTCTTACCTGCGACTCTATAATGGGATCGGACCGGGA[C/T]GAACAGAAATTGGTGAGAAACAGTAATGAACTTTATGTTCTTTTTGCATCAGTCACATTTGTTCCCAATACAAAAAAAGAAAACATTTACAAGTACATGTTGGGAAGAAAATGTTATTCGGTTGTTACTTTTTGTAATTTATTGCCCTAATTGCATGTTGTTAATACATAATTTTCATCAAAACAGAAATGGCTGTTAGACAAATCCTTATTGATCATGTTATTTATTATTTTAACAGAGTAATGTAGGTTTTTTTAGTTGTATGTTTATGTATTACAACCTCTTTAAACATTAATATTAACTTTTGACTAAACAAATTAAATAAATCACAATCGCTTAATGAAATTGCAGCATGCATTAGCTCTTTTCCCATCCACATATTTGTTAAGCATCTCTTGGAAAATGCCATAAAATGCCAATGTTGTTTTTTATTCAGTAAGAACACATCCAAATAAACTACAATGAAAAAAATCTCTGACTATTTACAATTATATGTCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27414
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089582 Essential Splice Site None 235 None 9
ENSDART00000113710 Essential Splice Site 257 671 None 15
ENSDART00000139863 Essential Splice Site 257 661 None 15
ENSDART00000140040 Essential Splice Site None 42 None 9
Genomic Location (Zv9):
Chromosome 9 (position 31061640)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30217586
GRCz11 9 30028332
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTACAGTGGAAATCTCTCCCCGAGCCTTTTTACTTTCAAGACCAGCGG[T/G]GAGTGAATCAGTAATGTATCAAACCCACTGTCAGTGTTTACCATTTACCC
Long Flanking Sequence:
AAACAACAAAGCAGCACATAGATCCGTCTTGGCATTATGAATCACGTGTTGCCATAGAAACGAACACTTTCTGAGTCAGAGGACCTGAACTGCTCTAAATTGTCATCTGGTAATTATGGTAATTCTGACATGACGTGAACACAGCATAAGTGACAGCCTAACATTTGCATACTGGATGTACGTGTATTGCCCCCAAAAATGATATTTTGCTGTGTGTGTTGATTCCTATGCACATTTAGTAGAAAACCAAATGTGTGCAAAACATCTCTCATTTCATTCACACGCAATTGAAGCCCCAAAAACTAAATTTACTTAAGGGTTTTGCTGCCTTGCAAGCACCGATGTTTCCTTCTTTAAATGCAAATCTAGTTTGATTGCGAATCCTTGGCTTGTATATTGTTGATGAATGGATTGATTGCTAGACAGAATGACAGCTCTGCGTCTTTCTCCTTTTACAGTGGAAATCTCTCCCCGAGCCTTTTTACTTTCAAGACCAGCGG[T/G]GAGTGAATCAGTAATGTATCAAACCCACTGTCAGTGTTTACCATTTACCCTCCAGTTTTGCCATCGCAATAGTTCAAAAATGATTTTATATAACTTCAATAAAGAAGTTTAAAATTTAATAAAGAAGTTTGTTCTTCATTCCTGTCACTTCTATAGAAATGGCCTGCACTTTGGCGCTCTAATAATAGAAACTTTAATTTTCTCCCACTTGAAGGTTGCTATGGTACTTTGGGTTTGGAGTCGGGGGTGGTGAGCGACTCTCAGATCACGGCCTCATCCGAGTGGGAATGGGGCGGTCATGGAAAACAGCCCACCGTCTGGGGCCCTACGGGGGCCCGCCTCAAAACTCCAGGACGTCCGTGGGCTGCAGCCAACAGCGACACCAAAGAATGGATTCAAGTGGACTTAAAGAAAGAGAAAAAAATAACAGGTATGCTCGTGTGTGCTTGAGTGTGTGTACAGGTTTTAGTGGTTTATAAGGACATATATTTGTAAATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21503
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089582 None None 235 None 9
ENSDART00000113710 Nonsense 396 671 10 15
ENSDART00000139863 Nonsense 396 661 10 15
ENSDART00000140040 None None 42 None 9
Genomic Location (Zv9):
Chromosome 9 (position 31055841)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30211787
GRCz11 9 30022533
KASP Assay ID:
2260-1955.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGGAGGTGCGAAACAACTTTATTCCTCCAATTGAGGCACGCTTTCTC[C/T]GAATATGTCCCTTACAGTGGCACCAGAGGATCGCCCTTAAAATGGAACTG
Long Flanking Sequence:
GCCTGTCAATCTCATGTTCCATCCTTCCCTCACTCATGAACTGTTTTATTTTATTTTATTTTATTTTATTTTAGCAGAAATTGAATTTGGCCAACACAAGCTTAGCTGAAAGCATATCCAGCTGAGTTTGTTTTGAAGCAGTGTGTTTTGTGTTTGTGTGGTGTGAATAAAGTGTTGGTATTGTCACTGCTGCAGAATGACATCACTTTCTTTGTATATTTGTAGGAAAAAAAGGGTTTTACATTCTTGAGGTTTTAGGAGGCTGAAATGAAAGTGCACTCTGTGGTCATTAATAATGAATGTCCATCGACTGTCAGCGGGCTTAACGAGAGATGCATTGATTAGGCGTAAATAAGACGAACCTTGAGCTGAGGCCAAATGTTCTTTGTTGCTAAAGCCTCGTTGTCCTTGTGTCTCTGAAACAGATTTTCCAAGGTAACACCCACTATCTGCAGGAGGTGCGAAACAACTTTATTCCTCCAATTGAGGCACGCTTTCTC[C/T]GAATATGTCCCTTACAGTGGCACCAGAGGATCGCCCTTAAAATGGAACTGCTGGGCTGCCAACCCCATGCAGGTGAGAAAACCGCTCACTTGTTCACTCATTCACTAATCCCTATATAGTGGATGGCAGCTTGAGTTGACTATATTAGGAAAGAGGGGATGAAAATGAGTGAGTGAATTTAGACGGTGGTTAAAATAGTGTGACCCAGAAAACAGTCTGTGCCGACTATTTGGTGATAAACATTACACGTTGTAATACAGTGGGCGGGGAAATTATTCAACACGTCAAGTTTTTTTTTTTTTCTTGGGAAAAATGTTCTAAAGGAGCTGTTGAGATGGAATTGAACCAGAATTTGGTAAAAACCCAAACAATACAAACATAAAAATAAAACAAAACAAAAAAGTGCAATGTTTTTGTGTAATAGCAATGGAATGATACTAGGAGAAAGTAATGAACTACTGAAATGTATTTAATACTTTTATATTAAATAAGAAATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41444
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089582 None None 235 None 9
ENSDART00000113710 Nonsense 452 671 11 15
ENSDART00000139863 Nonsense 452 661 11 15
ENSDART00000140040 None None 42 None 9
Genomic Location (Zv9):
Chromosome 9 (position 31052656)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30208602
GRCz11 9 30019348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGCACAACACCGCCAGCGCAGGACAGGACCACACACACACCCAACATC[C/T]GAAACTCCACCATGCCTCCACACTCCCATGACGGTAAGATATTCTGCATT
Long Flanking Sequence:
ATTTCACAGGAGGGCAAACAATATAATATTAACTAAATAGCAGAATATGCTGTAGTTATAATAGAAAGTATAAATCTATTAAAATAAAGAAACCCTTCATACTATATGAACATGAAATATTCTGAGATATGAACAACAAAATTAAATGAGCCAAAATTCATGTCAATCATGCTTCTTTTTCATTTTTTAATATTGCTTCTATAAGTCTGAAATTTGTGAAAATGTTGCTTTATTGAATGAAATTCATGTGAATTACTGTCAAAAAAGTAGTGAAAAAATTTAGGGTATAAAGTCACTCACTTTATAGTGGATAGAGAGTGGTTTCAGACACCACTTGAGAAATTGCTATCAGATTTGCTCAATTAGTCATGTTTGGAAGCTTGATTGGATCTTTGTCTTTGTCAGCGAGGCCCAGAATCTTCCACCCAGGCCCTGCACCTCCTCGCAGGAAGAGCACAACACCGCCAGCGCAGGACAGGACCACACACACACCCAACATC[C/T]GAAACTCCACCATGCCTCCACACTCCCATGACGGTAAGATATTCTGCATTCACTACAGCAACATTACATCACTACAAGCTCTGTTATAAGCCTGCCTCCGTCCTTCATACAGAGTCTGTTCTTATGTTTAAAAATGCAGGCCAGTGGAATAAATAAATAAAATCAACTAGAAGAAACATTTTCAAAGTTGAACTTCTTTCAATTTAAGTTGCCGGTTCTTTGGATGTTGTGTCGAGAGCCTTGCAACTTGTAATTTCTGAAAACAGCAGAAAATACAGTTGAAAACAGGGAATTTTCCAGATATCCTAGAATTTTGCCAAATGGGTTAATAATCAGAACTGACATTGTACACCAAATCTATCTATTATATGGATTAATGTCTGTGAATTTAAAAGCGTAAACCACTATATGGTCTTACTCATCTACACAAGTGGATTCACGACATCTTGTTGAAATAAAAATTCTGTTTAGTTTAAAGAAATTCTGATACACATGGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8562
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089582 None None 235 None 9
ENSDART00000113710 Essential Splice Site 462 671 11 15
ENSDART00000139863 Essential Splice Site 462 661 11 15
ENSDART00000140040 None None 42 None 9
Genomic Location (Zv9):
Chromosome 9 (position 31052622)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30208568
GRCz11 9 30019314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACACACCCAACATCCGAAACTCCACCATGCCTCCACACTCCCATGACG[G/T]TAAGATATTCTGCATTCACTACAGCAACATTACATCACTACRAGCTCTGT
Long Flanking Sequence:
AAATAGCAGAATATGCTGTAGTTATAATAGAAAGTATAAATCTATTAAAATAAAGAAACCCTTCATACTATATGAACATGAAATATTCTGAGATATGAACAACAAAATTAAATGAGCCAAAATTCATGTCAATCATGCTTCTTTTTCATTTTTTAATATTGCTTCTATAAGTCTGAAATTTGTGAAAATGTTGCTTTATTGAATGAAATTCATGTGAATTACTGTCAAAAAAGTAGTGAAAAAATTTAGGGTATAAAGTCACTCACTTTATAGTGGATAGAGAGTGGTTTCAGACACCACTTGAGAAATTGCTATCAGATTTGCTCAATTAGTCATGTTTGGAAGCTTGATTGGATCTTTGTCTTTGTCAGCGAGGCCCAGAATCTTCCACCCAGGCCCTGCACCTCCTCGCAGGAAGAGCACAACACCGCCAGCGCAGGACAGGACCACACACACACCCAACATCCGAAACTCCACCATGCCTCCACACTCCCATGACG[G/T]TAAGATATTCTGCATTCACTACAGCAACATTACATCACTACAAGCTCTGTTATAAGCCTGCCTCCGTCCTTCATACAGAGTCTGTTCTTATGTTTAAAAATGCAGGCCAGTGGAATAAATAAATAAAATCAACTAGAAGAAACATTTTCAAAGTTGAACTTCTTTCAATTTAAGTTGCCGGTTCTTTGGATGTTGTGTCGAGAGCCTTGCAACTTGTAATTTCTGAAAACAGCAGAAAATACAGTTGAAAACAGGGAATTTTCCAGATATCCTAGAATTTTGCCAAATGGGTTAATAATCAGAACTGACATTGTACACCAAATCTATCTATTATATGGATTAATGTCTGTGAATTTAAAAGCGTAAACCACTATATGGTCTTACTCATCTACACAAGTGGATTCACGACATCTTGTTGAAATAAAAATTCTGTTTAGTTTAAAGAAATTCTGATACACATGGCAGCATGATGGCTCAGTGGTTAACACTGTTGCCTTACA
Associated Phenotype:
Not determined