Busch Lab

ZMP

camsap1l1

Ensembl ID:
ENSDARG00000062173
ZFIN ID:
ZDB-GENE-030131-3016
Description:
calmodulin regulated spectrin-associated protein 1-like 1 [Source:RefSeq peptide;Acc:NP_001038461]
Human Orthologue:
CAMSAP1L1
Human Description:
calmodulin regulated spectrin-associated protein 1-like 1 [Source:HGNC Symbol;Acc:29188]
Mouse Orthologue:
Camsap1l1
Mouse Description:
calmodulin regulated spectrin-associated protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1922434]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa43837 Nonsense Mutation detected in F1 DNA Not yet available
sa44986 Nonsense Mutation detected in F1 DNA Not yet available
sa6710 Nonsense Mutation detected in F1 DNA Not yet available
sa15817 Nonsense Available for shipment Available now
sa1309 Nonsense Available for shipment Available now
sa24164 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43837
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089569 Nonsense 580 1410 11 17
ENSDART00000142947 Nonsense 577 1407 11 17
Genomic Location (Zv9):
Chromosome 22 (position 22717102)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22328738
GRCz11 22 22353716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGAGGACATCCAAGAGACACTCGACGAGGACTCATCCCTAAGGGATTG[T/A]ACTGTCAGCATGGAGTTTGACATGGATCAAGACTTTGAGGCGAGAGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44986
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089569 Nonsense 829 1410 11 17
ENSDART00000142947 Nonsense 826 1407 11 17
Genomic Location (Zv9):
Chromosome 22 (position 22716357)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22327993
GRCz11 22 22352971
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTAATCATGCAGATGCGGGAGCAACAAGCTTGGGTTGTGTCACCACAT[C/T]AGCCTTCACCACAAAAGCAGGTACGAGAGCTCAGAGGGAGTGGGGCGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6710
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089569 Nonsense 922 1410 11 17
ENSDART00000142947 Nonsense 919 1407 11 17
Genomic Location (Zv9):
Chromosome 22 (position 22716076)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22327712
GRCz11 22 22352690
KASP Assay ID:
554-4866.1 (used for ordering genotyping assays)
KASP Sequence:
CGCCTAAGAAGATTCTCCCCATCTCAGCCCATGTCCTGCTCATTTTCWTA[T/A]ATGGGAAACGAGAAGAAACCATTATCAACAGCTGACAAAGACATTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15817
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089569 Nonsense 1078 1410 11 17
ENSDART00000142947 Nonsense 1075 1407 11 17
Genomic Location (Zv9):
Chromosome 22 (position 22715610)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22327246
GRCz11 22 22352224
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAGGAGGCCTCTGGGGAAAATCARGATGAYGATCAGAAAGCGTGYTGT[G/T]GATTCTTCTTCAAGGTARAGAATAATCCTGTAGATAAATCTTMTGATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1309
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089569 Nonsense 1122 1410 12 17
ENSDART00000142947 Nonsense 1119 1407 12 17
Genomic Location (Zv9):
Chromosome 22 (position 22714479)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22326115
GRCz11 22 22351093
KASP Assay ID:
554-1224.1 (used for ordering genotyping assays)
KASP Sequence:
GAGAACGGGAAAGCCAGCAGAGAAAACAGCAGCTGGAGGCWGAGCATGAG[C/T]AGAAGAAAGAGGAGGCTAGGTAAGAGCCAGCTCAGCTGTCAATCAAAGAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa24164
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089569 Essential Splice Site 1232 1410 14 17
ENSDART00000142947 Essential Splice Site 1229 1407 14 17
Genomic Location (Zv9):
Chromosome 22 (position 22712740)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22324376
GRCz11 22 22349354
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTCTCTTGGAGATAATGACAGCGTCAACTCCGATAAGAAAACACCCAG[G/A]TAAGAGCCAGTTAGGCAAAAAGAATATTTATTTCCTGTTTCCCAGCAATT
Associated Phenotype:
Not determined