Busch Lab

ZMP

olfml3b

Ensembl ID:
ENSDARG00000062171
ZFIN ID:
ZDB-GENE-050302-161
Description:
Olfactomedin-like protein 3A [Source:UniProtKB/Swiss-Prot;Acc:Q29RB4]
Human Orthologue:
OLFML3
Human Description:
olfactomedin-like 3 [Source:HGNC Symbol;Acc:24956]
Mouse Orthologue:
Olfml3
Mouse Description:
olfactomedin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1914877]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa9043 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9043
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089601 Nonsense 146 390 3 3
Genomic Location (Zv9):
Chromosome 11 (position 25606252)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24435077
GRCz11 11 24672693
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGACTGCAGTGATATGATCTCCAGCATCAAAGCCATGAARATCCTCAAA[C/T]GAGTGGGCGGTGCTAAGGGCATGTGGACCAAGGACATGGGAAGCGYCACT
Associated Phenotype:
Not determined