Busch Lab

ZMP

si:ch211-88n13.1

Ensembl ID:
ENSDARG00000062156
ZFIN ID:
ZDB-GENE-070912-325
Description:
Novel protein similar to vertebrate ABI gene family, member 3 (NESH) binding protein (ABI3BP) [Sourc
Human Orthologue:
ABI3BP
Human Description:
ABI family, member 3 (NESH) binding protein [Source:HGNC Symbol;Acc:17265]
Mouse Orthologue:
Abi3bp
Mouse Description:
ABI gene family, member 3 (NESH) binding protein Gene [Source:MGI Symbol;Acc:MGI:2444583]

Alleles

There are 13 alleles of this gene:

Allele Name Consequence Status Availability
sa41446 Nonsense Mutation detected in F1 DNA Not yet available
sa41445 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12479 Essential Splice Site Available for shipment Available now
sa31723 Nonsense Available for shipment Available now
sa21504 Nonsense Available for shipment Available now
sa8500 Nonsense Mutation detected in F1 DNA Not yet available
sa18355 Essential Splice Site Available for shipment Available now
sa9166 Nonsense Mutation detected in F1 DNA Not yet available
sa7190 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41446
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 41 1072 1 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 Nonsense 45 128 1 3
Genomic Location (Zv9):
Chromosome 9 (position 31194074)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30350020
GRCz11 9 30160766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGACTGGGAGGGTATATCCTGGGCTATGGCAGCAGCATGTTCTCCAAA[C/T]AATTCATCCAGCTGCCGGAGGATGGACAACCTTATGAGACTGAGATAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41445
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Essential Splice Site 56 1072 1 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 Essential Splice Site 60 128 1 3
Genomic Location (Zv9):
Chromosome 9 (position 31194025)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30349971
GRCz11 9 30160717
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAATTCATCCAGCTGCCGGAGGATGGACAACCTTATGAGACTGAGATAG[G/A]TAATGTCGTTCTTCTACTCTTTAAATAACTTTAGTGCTTTTTAAAACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12479
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Essential Splice Site 57 1072 None 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 Essential Splice Site 61 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31194024)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30349970
GRCz11 9 30160716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAATTCATCCARCTGCCGGAGGATGGACAACCWTATGAGACTGAGATAGG[T/A]AMTGTCGTTCTTCTACTCTTTAAAWAAYTTTAGTGCTTTTTAAAACTGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27418
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 139 1072 4 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31191080)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30347026
GRCz11 9 30157772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCAGACATTTCACAGTGCGCTACAGAGAACAAGAGCCCAGCAATACCT[G/A]GAACTATCAAACCTGTCCATCCTCCAGCACAGTCATCGACAACCTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31723
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 144 1072 4 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31191064)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30347010
GRCz11 9 30157756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCGCTACAGAGAACAAGAGCCCAGCAATACCTGGAACTATCAAACCTG[T/A]CCATCCTCCAGCACAGTCATCGACAACCTCAAACCAGATGTGTTGTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21504
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 471 1072 9 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31187925)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30343871
GRCz11 9 30154617
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTAGCAGACAACCAGTATTTAGCACTACTGCATCCACCTATACCAAATA[T/A]TCTATATTCCATATTCCCACAACTGAAGATCCTCCTCTTAACAAAAGTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5547
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 607 1072 11 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31185388)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30341334
GRCz11 9 30152080
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTGAGAGCCTTATCATTACAATATGTTCAGCATTGTTTGAGACTTATG[T/A]AAGTTTGCCTTTGTATGTCAGCTAGTTCCCAGCGAAAGGACAAACGAGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27417
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 634 1072 11 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31185307)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30341253
GRCz11 9 30151999
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGAAAGGACAAACGAGTACTGTCACAGCCAACACTTACAAATGAGGTG[G/A]CCGGTAGGAATAAGGGTAATGATGTCAGATCTATTTTATTTGTCCTAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27416
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Essential Splice Site 654 1072 12 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31182409)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30338355
GRCz11 9 30149101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAATATAAAGCCACCAGTACTAAATAATATGTCAATGATGTCAAAATG[T/C]TATGATCTGGCATTGGTAGATAGTTAGTTCTGCACTTTGTGCCTAAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8500
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 674 1072 13 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31181877)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30337823
GRCz11 9 30148569
KASP Assay ID:
2260-1962.1 (used for ordering genotyping assays)
KASP Sequence:
GGCCTCATGGTGAGGGTCACATAGGCCTTCATGGAWACAAGCCTAGAAAA[C/T]AACCTGGTAAACTCTTTTATGGATTATYTTTGAAGRTTATTTAGTNNNNNNNNNNAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18355
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Essential Splice Site 676 1072 14 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31181644)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30337590
GRCz11 9 30148336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTGCTTACAGGTTTAATGTGGTGTTTCAGATAGATGTCCCTGTTTTGT[T/A]GAAAACAWCTCCTGTGCAGAAAACGATTCCCAWGCAGCTGGATTTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9166
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 751 1072 17 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
ENSDART00000089543 Nonsense 751 1072 17 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31179881)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30335827
GRCz11 9 30146573
KASP Assay ID:
554-5132.1 (used for ordering genotyping assays)
KASP Sequence:
AAWAGGAAATAGTKAATAGYGAGAATTGATCCCTGCCAGATGTTACCAAC[C/T]AAGTGTTACCAAATAATGTWAAAAAAATCCTWTTAATTTTGTCATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7190
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 751 1072 17 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
ENSDART00000089543 Nonsense 751 1072 17 26
ENSDART00000133746 None None 290 None 8
ENSDART00000143986 None None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31179881)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30335827
GRCz11 9 30146573
KASP Assay ID:
554-5132.1 (used for ordering genotyping assays)
KASP Sequence:
AAWAGGAAATAGTKAATAGTGAGAATTGATCCCTGCCAGATGTTACCAAC[C/T]AAGTGTTACCAAATAATGTAAAAAAAATCCTWTTAATTTTGTCATTTCTA
Associated Phenotype:
Not determined