Busch Lab

ZMP

ranbp10

Ensembl ID:
ENSDARG00000062138
ZFIN ID:
ZDB-GENE-070705-86
Description:
Ran-binding protein 10 [Source:UniProtKB/Swiss-Prot;Acc:Q1LUS8]
Human Orthologue:
RANBP10
Human Description:
RAN binding protein 10 [Source:HGNC Symbol;Acc:29285]
Mouse Orthologue:
Ranbp10
Mouse Description:
RAN binding protein 10 Gene [Source:MGI Symbol;Acc:MGI:1921584]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23301 Essential Splice Site Available for shipment Available now
sa39200 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23301
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089507 Essential Splice Site 524 604 12 14
ENSDART00000146261 Essential Splice Site 529 609 12 15
Genomic Location (Zv9):
Chromosome 18 (position 21788645)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22018868
GRCz11 18 22007934
KASP Assay ID:
2261-2195.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTCTGCCGCCAGTATGGCAAGAATGCCACTCACAAGAAGATGCTGCAG[G/A]TAGGAGGAATAGAAGGGGAAAAGGAGGATAAGCTTGAGAAAGAGATGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39200
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089507 Essential Splice Site 562 604 13 14
ENSDART00000146261 Essential Splice Site 567 609 13 15
Genomic Location (Zv9):
Chromosome 18 (position 21790589)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22020812
GRCz11 18 22009878
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCATGCAAAGAGAGGCGATCTGCTCTGCTCTCAACAGTGCTATTCTGGG[T/A]AAGAAATAAGCTCTGTGAACATGATCGCTTTAATAGGCTTCACAATTTAA
Associated Phenotype:
Not determined