Busch Lab

ZMP

si:ch211-197k23.5

Ensembl ID:
ENSDARG00000062137
ZFIN ID:
ZDB-GENE-030131-1393
Human Orthologue:
STAG1
Human Description:
stromal antigen 1 [Source:HGNC Symbol;Acc:11354]
Mouse Orthologue:
Stag1
Mouse Description:
stromal antigen 1 Gene [Source:MGI Symbol;Acc:MGI:1098658]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa37909 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24517 Nonsense Available for shipment Available now
sa14968 Nonsense Available for shipment Available now
sa24516 Nonsense Available for shipment Available now
sa37908 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8039
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Nonsense 73 1256 3 33
ENSDART00000142864 Nonsense 73 1256 4 34
Genomic Location (Zv9):
Chromosome 24 (position 27850825)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26901412
GRCz11 24 26980571
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGGTCTCCGGTTGATAAAGGCGGGAGGAGGCCGAATGGAGTGGCCCAT[C/T]AGAATGGAGAGGGCACAGACCCTAGCACTCTGYTTGAGGTGGTCAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37909
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Essential Splice Site 96 1256 4 33
ENSDART00000142864 Essential Splice Site 96 1256 5 34
Genomic Location (Zv9):
Chromosome 24 (position 27850670)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26901257
GRCz11 24 26980416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAGGTTGTGTGCTGCTTTGTGACTGTTGTTTCGCTTTGCAAATGTTTCC[A/T]GTCGGTCATTGATGATTGGATTGAATCCTACAAGCAAGATCGAGACCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24517
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Nonsense 139 1256 5 33
ENSDART00000142864 Nonsense 139 1256 6 34
Genomic Location (Zv9):
Chromosome 24 (position 27848257)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26898844
GRCz11 24 26978003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGTCTTATTATCACAGGCACTGTACGGATCGAGATGTTCAGGAACATG[C/T]AGAATGCTGAAATAATCAGGAAAATGACAGAAGAGTTTGATGAGGTTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1455
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Essential Splice Site 272 1256 7 33
ENSDART00000142864 Essential Splice Site 272 1256 8 34
Genomic Location (Zv9):
Chromosome 24 (position 27844860)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26895447
GRCz11 24 26974606
KASP Assay ID:
554-1381.1 (used for ordering genotyping assays)
KASP Sequence:
GAAAAGAGCCAACGAGAAGCTGGAACTTCTGCTGGAGAAGAGGAAAGAGG[T/C]GGGATGTTGGTTTGTTTNNNNNTTTGTTTTGCTGAAATTTTGCATTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14968
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Nonsense 327 1256 9 33
ENSDART00000142864 Nonsense 327 1256 10 34
Genomic Location (Zv9):
Chromosome 24 (position 27842867)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26893454
GRCz11 24 26972613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGGTGTTTGGATGAAGTTGTACAGTGATGCTTTTCTTAATGACAGTTA[T/A]CTAAAGTACGTGGGTTGGACACTACATGACAGAGYAAGTGTTNNATTCATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4294
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Essential Splice Site 338 1256 9 33
ENSDART00000142864 Essential Splice Site 338 1256 10 34
Genomic Location (Zv9):
Chromosome 24 (position 27842832)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26893419
GRCz11 24 26972578
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTAATGACAGTTATCTAAAGTACGTGGGTTGGACACTACATGACAGAG[T/C]AAGTGTTATTCATAAGTTATTATCACACACAACAAATGTAATATTGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24516
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Nonsense 752 1256 21 33
ENSDART00000142864 Nonsense 752 1256 22 34
Genomic Location (Zv9):
Chromosome 24 (position 27835319)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26885906
GRCz11 24 26965065
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCTCATTACTCCATCCTGTGGCAGCTGGTGAAAATCACTGAAGGATG[T/A]CCATCAAAGGTACGGTACACACCAATAAATGCAGATGACAAAAATAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37908
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Essential Splice Site 1222 1256 31 33
ENSDART00000142864 Essential Splice Site 1222 1256 32 34
Genomic Location (Zv9):
Chromosome 24 (position 27822592)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26873179
GRCz11 24 26952338
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTAGAGGACATGAACGAGGAGTTTGAGGATACTATGGTCATAGATCTGG[T/A]AAGAGTTCACATATGTGACGAGTCCTTCAGTGTATTTTTGATGTTTCTGC
Associated Phenotype:
Not determined