Busch Lab

ZMP

sytl5

Ensembl ID:
ENSDARG00000062135
ZFIN ID:
ZDB-GENE-070912-424
Human Orthologue:
SYTL5
Human Description:
synaptotagmin-like 5 [Source:HGNC Symbol;Acc:15589]
Mouse Orthologue:
Sytl5
Mouse Description:
synaptotagmin-like 5 Gene [Source:MGI Symbol;Acc:MGI:2668451]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45361 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18597 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45361
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089488 Essential Splice Site 351 745 9 19
ENSDART00000131683 None None 369 None 8
ENSDART00000147030 None None 149 None 5
Genomic Location (Zv9):
Chromosome 9 (position 31373292)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30529238
GRCz11 9 30339984
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGTTCACAGTTTTTTTCCTCCGGTGTACAGGATATGGCTTCCGAACAG[G/A]GAGTTAAAATGATAAGAGACAGCCTGCTATAATGTGATTTTTCTGATATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27421
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089488 Essential Splice Site 493 745 14 19
ENSDART00000131683 Essential Splice Site 116 369 3 8
ENSDART00000147030 None None 149 None 5
Genomic Location (Zv9):
Chromosome 9 (position 31363921)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30519867
GRCz11 9 30330613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCATCAAAAGCAACAGCACAAACCCAGTGTTCAATGAGAACCTGAGGG[T/C]AAGAGGAGCTCACCGTGTTTTGTGTTGGGTTTGATGAGCTATTGATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18597
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089488 Nonsense 541 745 15 19
ENSDART00000131683 Nonsense 164 369 4 8
ENSDART00000147030 None None 149 None 5
Genomic Location (Zv9):
Chromosome 9 (position 31363695)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30519641
GRCz11 9 30330387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGAGCTCACCTTTGACTCCTGGGAGTTTGAYACGCAGATAGAAGAATG[G/A]TTTGCTCTGCAGCCTAGAGTGAGTATAGCWCACGCACACATATAGACAAA
Associated Phenotype:
Not determined