Busch Lab

ZMP

cyp4v2

Ensembl ID:
ENSDARG00000062132
ZFIN ID:
ZDB-GENE-061103-601
Description:
cytochrome P450, family 4, subfamily V, polypeptide 2 [Source:RefSeq peptide;Acc:NP_001071070]
Human Orthologue:
CYP4V2
Human Description:
cytochrome P450, family 4, subfamily V, polypeptide 2 [Source:HGNC Symbol;Acc:23198]
Mouse Orthologue:
Cyp4v3
Mouse Description:
cytochrome P450, family 4, subfamily v, polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:2142763]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4839
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089480 Nonsense 135 513 4 11

The following transcripts of ENSDARG00000062132 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16644714)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17209882
GRCz11 1 17902819
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAAATACATTCATTTTTATTTTTCCTTTGGTTAGTACTGGGGATAAGT[G/A]GAGACGCAGACGCAAGATGCTGACTCCAACATTTCATTTCTCSATACTAA
Long Flanking Sequence:
CTCAAATCATTTTACTTACAGTACATGTCAAATACATGTTCTTGTACATGCTCACATGAAGGCAGGGCTTGTTGTACAGCTCACATAGTAAACCACTGACATAAATGCTTTCGTAAACCCAACCCTTAGTGTTTTCAAAAGCAAACATTCACACTTTGACCACATTCAGCTTTATTTTACATTGCTTGATCTCTTTATATGGAACTGAGCTTCACTGGACTTGAGCCAGAGCCCTCCCCATCAAAACACAACATCATACAAAAATGAGCCACTATACTAAGAAATCTGATCATGCCAGAAAAGCAGGCTGTATGGCCAAGCTGCAGTCAAATGTGTGTTCAAGTGTTTGTGGTTTCGCAAAAAAGACAGCTGAACCATGCATTTCTAATGAGCCAGGGTTGCATTATTTGGATTGTTCATTTGCTTGCCGCAGAACTACAGGTCAAACATAGGAAATACATTCATTTTTATTTTTCCTTTGGTTAGTACTGGGGATAAGT[G/A]GAGACGCAGACGCAAGATGCTGACTCCAACATTTCATTTCTCGATACTAACTGAGTTCCTGGAGGTGATGAATGAGCAAGCAGAGGTGCTCATAGAGAAACTAGAAAAGCAAGCCGGAAAGGGCCCATTTAACTGCTTTAGCCACATCACTCTCTGTGCCCTTGACATCATCTGTGGTTTGTGTGATTTTTATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATAATGTATTTTATAGTAATGTTTAAAGGTTTTCTTTAACAATTTGTTTGCGTGTTTAGTTCAACTAAAATGTAAATTTACTCACTCATACTCAACATTTCAAACCACTTTTGTCATTCTGTATATTTATTCTGATGAACTCTAAAAAATCCTTATGAAGAAAGCTGGAAACCTGTTGCTATTGACCTCCATAGTGTGTTTTTTTTTTCTACGATAGAAGTCATTAGTTAC
Associated Phenotype:
Not determined