Busch Lab

ZMP

papd7

Ensembl ID:
ENSDARG00000062114
ZFIN ID:
ZDB-GENE-041021-1
Description:
Novel protein similar to vertebrate polymerase (DNA directed) sigma (POLS) [Source:UniProtKB/TrEMBL;
Human Orthologue:
PAPD7
Human Description:
PAP associated domain containing 7 [Source:HGNC Symbol;Acc:16705]
Mouse Orthologue:
Papd7
Mouse Description:
PAP associated domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2682295]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23540 Essential Splice Site Available for shipment Available now
sa23539 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23540
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089425 Essential Splice Site 714 762 12 14
ENSDART00000131767 Essential Splice Site 535 583 12 13
Genomic Location (Zv9):
Chromosome 19 (position 28296717)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28226829
GRCz11 19 27811052
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCCCCAGCTCCCCCCAGCCCTCTACCCAGTCCCCTTCACCATCCCAAG[G/A]TAGGCTGTCCTGTGTCTGCTCTCCTCTTCATGCTGTGAGTGTCATGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23539
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089425 Nonsense 743 762 13 14
ENSDART00000131767 Nonsense 564 583 13 13
Genomic Location (Zv9):
Chromosome 19 (position 28293140)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28223252
GRCz11 19 27807475
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCGCCGTGGTGCACAGTCCTGTCCTTTCCAACCGAGGCCACATTCAGTA[C/A]AACCGCAACACGTGGCGCCGCAGGAAGAGGGACAGTTTGCCGGCCAGCGT
Associated Phenotype:
Not determined