Busch Lab

ZMP

shdb

Ensembl ID:
ENSDARG00000062109
ZFIN ID:
ZDB-GENE-030131-6059
Description:
SH2 domain-containing adapter protein D [Source:RefSeq peptide;Acc:NP_001038542]
Human Orthologue:
SHD
Human Description:
Src homology 2 domain containing transforming protein D [Source:HGNC Symbol;Acc:30633]
Mouse Orthologue:
Shd
Mouse Description:
src homology 2 domain-containing transforming protein D Gene [Source:MGI Symbol;Acc:MGI:1099461]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16983 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16983
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089408 Nonsense 4 391 2 7
Genomic Location (Zv9):
Chromosome 22 (position 21721373)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21374621
GRCz11 22 21399599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACACGTAGAGTCTTTGTGCCTTTCCAAAGAGATCAGAATGGCRAAGTG[G/A]TTAAAGGACTATTTAAGTTTTGGGAGCAAAYGAGTTCCCCCGCAACCTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4194
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089408 Nonsense 15 391 2 7
ENSDART00000089408 Nonsense 15 391 2 7
Genomic Location (Zv9):
Chromosome 22 (position 21721404)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21374652
GRCz11 22 21399630
KASP Assay ID:
2261-6798.1 (used for ordering genotyping assays)
KASP Sequence:
AGATCAGAATGGCGAAGTGGTTAAAGGACTATTTAAGTTTTGGGAGCAAA[C/T]GAGTTCCCCCGCAACCTCCGAAGCCTGATTACACGGAGAGTGAGATCTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19295
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089408 Nonsense 15 391 2 7
ENSDART00000089408 Nonsense 15 391 2 7
Genomic Location (Zv9):
Chromosome 22 (position 21721404)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21374652
GRCz11 22 21399630
KASP Assay ID:
2261-6798.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATCAGAATGGCGAAGTGGTTAAAGGACTATTTAAGTTTTGGGAGCAAA[C/T]GAGTTCCCCCGCAACCTCCGAAGCCTGATTACACGGAGAGTGAGATCTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3174
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089408 Nonsense 241 391 5 7
Genomic Location (Zv9):
Chromosome 22 (position 21768144)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21421392
GRCz11 22 21446370
KASP Assay ID:
554-2993.1 (used for ordering genotyping assays)
KASP Sequence:
TTCTTTCCCCCTCCGTCTCTCTGTGTCCCACAGTGCAGTTTGAGGGTGCC[G/T]AGTGGGATCGTTCCTGTTCTCCCACTGAACGCCTGAGGTGCTCCAGGGCT
Associated Phenotype:
Not determined