Busch Lab

ZMP

im:7147934

Ensembl ID:
ENSDARG00000062108
ZFIN ID:
ZDB-GENE-050208-308
Human Orthologue:
IFFO1
Human Description:
intermediate filament family orphan 1 [Source:HGNC Symbol;Acc:24970]
Mouse Orthologue:
Iffo1
Mouse Description:
intermediate filament family orphan 1 Gene [Source:MGI Symbol;Acc:MGI:2444516]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa28625 Nonsense Mutation detected in F1 DNA Not yet available
sa36088 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28626
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089386 Essential Splice Site 357 640 3 9
ENSDART00000123011 Essential Splice Site 357 614 3 17

The following transcripts of ENSDARG00000062108 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 19206938)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17237261
GRCz11 16 17145238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAAATAATTATTTATAATATCTATGTATGTGTTTTTGTCTATATGTGT[A/G]GGACCTACAGGAGAGTGAAGTATGTCAGGATGAATTGGCCCTCAAGGTCC
Long Flanking Sequence:
ATGTTAAATAAAAATAATACCTTGTAAAATTGTATTTAATGTTTACAATGCAAATCCTATTAGATACATTTGTTTGGTAAACAAAGCAAGTCTTTTATATAATATATATTCTAAAAGACAGTAACTATTACTTTACAAAATGTATTTTAGGCAAATCATATGAACATTTTCATATTTATAAAATGACTGAAATTAATTTAAAAACTGAATAAATATAAAATGACACACATTTACACACAATTAAATAAATAGACTCAATGATGGGTTAAAAATTTGTGGAAATCTGCAGATTTCTGTACGCGCAGATTCAGTGTGGGCATACCAATACTGTATGTTCATTTTTTTCTGTATTTGAGTCAGTAGATTTATTGCCATGCTGCATGATATGAATTAAAGTATACGAATACCAAATGATGATATGTGCACAATGTCCATATGTTTTCTGTATAGCAAAAATAATTATTTATAATATCTATGTATGTGTTTTTGTCTATATGTGT[A/G]GGACCTACAGGAGAGTGAAGTATGTCAGGATGAATTGGCCCTCAAGGTCCAACAGCTGAAAGCTGAACTTGTGCTCTTTAAAGGACTCATGAGCAATGTGAGTGTCAGAAGCAAAACATACTCAGTACAAGTACACACAGCTGGCTCTACTATAAATGCATATTGCAAACTCACTGAAGCACACAGGAAATAACCACTCAATTAAAAATAGCTTTCAGGTTCAAACACTGATACCTCGTTTCCACTGAGTGGTACAGGTACAGAAAGCTGTAAAGGCGGTTCATATATTGTGTGTTTGCACGCTCAAGTTCATTATTTCAAATACAGGTTTTTGCCAAAAAATGTGAATATTGAGGGGAAACTCAGTTTATTTCAATAATTTGTTTCAAAAAGTGAAACTTGTGTGTTATTTTAATTCACTAAACACAAAGTGAAATATATCAAGCCTTTGTTTGTTTCAATTTGAATGATTATGAATCAAAGATGACAAAAAACTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28625
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089386 Nonsense 364 640 3 9
ENSDART00000123011 Nonsense 364 614 3 17

The following transcripts of ENSDARG00000062108 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 19206913)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17237236
GRCz11 16 17145213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTATGTGTTTTTGTCTATATGTGTAGGACCTACAGGAGAGTGAAGTATG[T/A]CAGGATGAATTGGCCCTCAAGGTCCAACAGCTGAAAGCTGAACTTGTGCT
Long Flanking Sequence:
AAAATTGTATTTAATGTTTACAATGCAAATCCTATTAGATACATTTGTTTGGTAAACAAAGCAAGTCTTTTATATAATATATATTCTAAAAGACAGTAACTATTACTTTACAAAATGTATTTTAGGCAAATCATATGAACATTTTCATATTTATAAAATGACTGAAATTAATTTAAAAACTGAATAAATATAAAATGACACACATTTACACACAATTAAATAAATAGACTCAATGATGGGTTAAAAATTTGTGGAAATCTGCAGATTTCTGTACGCGCAGATTCAGTGTGGGCATACCAATACTGTATGTTCATTTTTTTCTGTATTTGAGTCAGTAGATTTATTGCCATGCTGCATGATATGAATTAAAGTATACGAATACCAAATGATGATATGTGCACAATGTCCATATGTTTTCTGTATAGCAAAAATAATTATTTATAATATCTATGTATGTGTTTTTGTCTATATGTGTAGGACCTACAGGAGAGTGAAGTATG[T/A]CAGGATGAATTGGCCCTCAAGGTCCAACAGCTGAAAGCTGAACTTGTGCTCTTTAAAGGACTCATGAGCAATGTGAGTGTCAGAAGCAAAACATACTCAGTACAAGTACACACAGCTGGCTCTACTATAAATGCATATTGCAAACTCACTGAAGCACACAGGAAATAACCACTCAATTAAAAATAGCTTTCAGGTTCAAACACTGATACCTCGTTTCCACTGAGTGGTACAGGTACAGAAAGCTGTAAAGGCGGTTCATATATTGTGTGTTTGCACGCTCAAGTTCATTATTTCAAATACAGGTTTTTGCCAAAAAATGTGAATATTGAGGGGAAACTCAGTTTATTTCAATAATTTGTTTCAAAAAGTGAAACTTGTGTGTTATTTTAATTCACTAAACACAAAGTGAAATATATCAAGCCTTTGTTTGTTTCAATTTGAATGATTATGAATCAAAGATGACAAAAAACTTCATGACAAAATTCAACATTGTAGCTCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28624
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089386 Nonsense 384 640 3 9
ENSDART00000123011 Nonsense 384 614 3 17

The following transcripts of ENSDARG00000062108 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 19206855)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17237178
GRCz11 16 17145155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTGGCCCTCAAGGTCCAACAGCTGAAAGCTGAACTTGTGCTCTTTAAA[G/T]GACTCATGAGCAATGTGAGTGTCAGAAGCAAAACATACTCAGTACAAGTA
Long Flanking Sequence:
AAGCAAGTCTTTTATATAATATATATTCTAAAAGACAGTAACTATTACTTTACAAAATGTATTTTAGGCAAATCATATGAACATTTTCATATTTATAAAATGACTGAAATTAATTTAAAAACTGAATAAATATAAAATGACACACATTTACACACAATTAAATAAATAGACTCAATGATGGGTTAAAAATTTGTGGAAATCTGCAGATTTCTGTACGCGCAGATTCAGTGTGGGCATACCAATACTGTATGTTCATTTTTTTCTGTATTTGAGTCAGTAGATTTATTGCCATGCTGCATGATATGAATTAAAGTATACGAATACCAAATGATGATATGTGCACAATGTCCATATGTTTTCTGTATAGCAAAAATAATTATTTATAATATCTATGTATGTGTTTTTGTCTATATGTGTAGGACCTACAGGAGAGTGAAGTATGTCAGGATGAATTGGCCCTCAAGGTCCAACAGCTGAAAGCTGAACTTGTGCTCTTTAAA[G/T]GACTCATGAGCAATGTGAGTGTCAGAAGCAAAACATACTCAGTACAAGTACACACAGCTGGCTCTACTATAAATGCATATTGCAAACTCACTGAAGCACACAGGAAATAACCACTCAATTAAAAATAGCTTTCAGGTTCAAACACTGATACCTCGTTTCCACTGAGTGGTACAGGTACAGAAAGCTGTAAAGGCGGTTCATATATTGTGTGTTTGCACGCTCAAGTTCATTATTTCAAATACAGGTTTTTGCCAAAAAATGTGAATATTGAGGGGAAACTCAGTTTATTTCAATAATTTGTTTCAAAAAGTGAAACTTGTGTGTTATTTTAATTCACTAAACACAAAGTGAAATATATCAAGCCTTTGTTTGTTTCAATTTGAATGATTATGAATCAAAGATGACAAAAAACTTCATGACAAAATTCAACATTGTAGCTCCATGTGTTTTAATCTTGTCTGCTAATGAATGCAAAGCCTTGAAATGGTCTCAGTCTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36088
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089386 None None 640 None 9
ENSDART00000123011 Essential Splice Site None 614 11 17

The following transcripts of ENSDARG00000062108 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 19176988)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17207311
GRCz11 16 17115288
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAAACGGCAGAGAAGCATCAAACAATTGCAGCGATAGTTGTCCAGCAG[G/T]TGAGAAAGCATGTTGAGCTGGTACTTTTTTATTAGAATCATATGTGGTAT
Long Flanking Sequence:
ATAAGTAGAAGTCAACCAAAGCTTTGTTTGAGAGACACAAATATACTTATCCCAAGTTCCTCTGATGCAAAATGGTATGTTTATTTAAAAAAAAAAAAAAAAGCTATCTTTTCCTTATTTAAAAGTTTCTTTTCTAGAGTAGGCCTATGTGATGCTGTTCGAATGAATGTATGATTTTATTATTTACAGATGCGTACGACTGTGTTATCTGTAGCCTTGGTGATGCTGACAGGTCATCTGATATATGGCCTCCCTATGGTAAATTTGTATGCTCCGATAACATCCACTGTATGTGTTATATTGTGTTAACTTCATGTAACTTGAAATTGTGTTGTAAAAAGCTCTTTCTTTTCAAATTAATCACTTCAAAAATTAATTGTGTCCATATTAGAGGCTTTAGCTTATGATTTTCTTGTGTGTTTCCATTTGTTTTTAGCATAACGGAAAGGTGAGAAACGGCAGAGAAGCATCAAACAATTGCAGCGATAGTTGTCCAGCAG[G/T]TGAGAAAGCATGTTGAGCTGGTACTTTTTTATTAGAATCATATGTGGTATCACATTCTTCGAATTATTTCCTTGTTTTTGCAGTGTGCGTGAGTGTACTTTTCTGTCACAACACTTCCCAGTATTACGTATGTGGTCTGGTCAGGAAATTGGCTAAGAAATCGATAGTTATTTGTTAAGTTTGTCTTTATCGTTCGCTCTTTTTTTTCTTTCTCCCTCTCTTCATTTTCTCTCATGATGGGAAATGGTTTGCTCTGACACAGAAGAGTAAACCACTTCCTTCATTAAAATGCTACTGCCGGTTTGAGCTTCTCTGCAACGTCCTGTTTTTGATGCTATTTCTCGTCTCTCTTCTTAAGAGACCTCAGTCAGCAAGTATGACTTTGTGCACAGAAGTGTGTGTGTGTGCGCACATATATGTGAGTGCATCTGTCTGCTGAGCACCCACATCCGTTTTTTAGAGATTCAGCATGTGCCCTTTAAGCGGAGTTCTGTGCACAG
Associated Phenotype:
Not determined