Busch Lab

ZMP

uggt2

Ensembl ID:
ENSDARG00000062089
ZFIN ID:
ZDB-GENE-050517-21
Description:
Im:7146988 protein [Source:UniProtKB/TrEMBL;Acc:A3KNY0]
Human Orthologue:
UGGT2
Human Description:
UDP-glucose glycoprotein glucosyltransferase 2 [Source:HGNC Symbol;Acc:15664]
Mouse Orthologue:
Uggt2
Mouse Description:
UDP-glucose glycoprotein glucosyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:1913685]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa16689 Nonsense Available for shipment Available now
sa45358 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41436 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13827 Nonsense Available for shipment Available now
sa7187 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16689
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089354 Nonsense 75 575 4 17
ENSDART00000125632 Nonsense 75 1527 4 41

The following transcripts of ENSDARG00000062089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 30466770)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29622716
GRCz11 9 29433462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAWGCTGATATGTACTTTTCTGTCTTTAGAGTCTGTCCGCTCCTATTA[T/A]AACCTGATCCTCAAGAAGGCTGGCCARTTTTTGACGGATCTTCAGGTCAA
Long Flanking Sequence:
TTGTTTTTAGTACGAGGAGAAGATCCTTTCATGTGTTCTCTTTAAAAAAGCACTTTACCTATGAAACATGTTCTCCTAGATCGCTTGAATTCTGTGAGGAATTAATTTTACTCAGTAAACATTTTATAGAGATTTTTTAACACAGTTTCTTCAAATGCAAAAACAAATTGTAAACATTTAATGTAATCTAACCAGAGTATACATTACATTTTCTTGCCATGAAAATCTCCACAGAAGCTGGCATGGTTTTAAACACAAACAAACAAACAAACAAACAAACAAAAACATTTTTTGTTACTCTCCTTTTATACAGTGAATTCATCAGGGAAGATGGAGACGAGAAATTCTGGCAGTTTGTCGATACTGTGAAGGAGTTAACTGTTTACAAATCTGGAGGTAATGACTCACATTTCATCTGCTTTGATTTCTAATACTGCATTTGAACTGTAAATGATGCTGATATGTACTTTTCTGTCTTTAGAGTCTGTCCGCTCCTATTA[T/A]AACCTGATCCTCAAGAAGGCTGGCCAGTTTTTGACGGATCTTCAGGTCAACTTGCTGAAGCTCTCTCTGTCTCTCAGGACTTACTCTCCAGCTGTACATGCTCTCCAACAAGTAAGTCTTTTTATCACATAGACTGGTTTTTCTAGCAAGTATACATATAGATATTTTTCCAGATTTTTATTTGCCAGGGCAAGTTTTAAATGTTACTTAAACTGTTAAATATTTTGGACACATAATTATTGAAGATATGAGTGATGATAATGCTATGTACAGGGAATGTCGAAAGCTAATATGCTGGTGAGAGTTTTATTTGTGTTCAGAGCAGGTTAACGTAAACCTCTTTAAAACCTATTGAAGTTTTTTATACAGCTCCTCTGTGGTATAATAAAAAAAAAAGAGACTCAATAAGCTGTAGGTTGCACACAATGATTGTATGAGGGTTCTTCTTTAAAAACATGGAGTAGTGCAAGTGAATTATTTTGTATGGAAAGAGTTTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45358
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089354 Essential Splice Site 150 575 5 17
ENSDART00000125632 Essential Splice Site 150 1527 5 41
ENSDART00000089354 Essential Splice Site 150 575 5 17
ENSDART00000125632 Essential Splice Site 150 1527 5 41

The following transcripts of ENSDARG00000062089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 30467712)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGCAGCACCAAGGATATGAAGAAGCTCTTGAAAACAGCCGCAGACAGG[T/A]AATGCTAACCGAATATACTGTATTCTTAGAGAAAATAATTTGTTCTGTGT
Long Flanking Sequence:
TCTTCTTTAAAAACATGGAGTAGTGCAAGTGAATTATTTTGTATGGAAAGAGTTTGATCATTTTTTCGATTAGAATTTTGATCCATAAGTTTATCTGTCACTTGGAGAAGTCTCAGAATGGCATTTTAATGTTGTTGATAAACCCTAGGCTTACTGAGGTGCGCTTTCAGTCACCTGTGATGAAATATTAGCATATCTTTCTTTTTTAATGTATAATGTGTGGTTTGTATTGTTTTGTCTGCATTTTGTACTATTGGAGCTTGTGTCTGGAATAAAGAGAATTATTTAATTCTAAAAAACATTTTTATTTTATCCATCTGAAATTTATTTAACTGTGAGGTAAACCTCACAGACAATACTGTTAACCCTTTCTTTTCATTCTGTAGATAGCAAGCGATGAACCTCCTCCTGAAGGCTGCTCTGCTTTTGTGGTTGTTCATGGTCAAAATGCCTGCAGCACCAAGGATATGAAGAAGCTCTTGAAAACAGCCGCAGACAGG[T/A]AATGCTAACCGAATATACTGTATTCTTAGAGAAAATAATTTGTTCTGTGTCAAAATCAGTTGTTTTCCTATAACATCTTTGTTGTGCTGTACGTTTTATTCAATTAATCCAGGCCAAGACCTTACCTATACAAGTCTGACCACCAATACCCAGGAGTCAATGGGACAGATGTGCCTGTAGCTATTCTTTATGCTGAAATTGGCACTAAGGAGTTCAGTACTTTTCATAAGGTTCTGTCTGAGCGAGCACAGGAGGGCAAACTTATCTATGTGCTGCGACATTTTGTGTCTGTAAGTATTAGCAGTGTAATTTCTCTATGTTCATACTGTGGGCAAATCAGATTTTTGTCATTTTCATAGTTGCAAGCGATCAAGTATAATTTATATGATCAGACATGGGTTGCTTTGGTAATTACATAGACTTATTCACATGTGTGACATCCCATTCAGATAAAGATTAAGGTTAGGATACATTAGGATTAGCTGTGCATAGAAACCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41436
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089354 Essential Splice Site 150 575 5 17
ENSDART00000125632 Essential Splice Site 150 1527 5 41
ENSDART00000089354 Essential Splice Site 150 575 5 17
ENSDART00000125632 Essential Splice Site 150 1527 5 41

The following transcripts of ENSDARG00000062089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 30467712)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29623658
GRCz11 9 29434404
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGCAGCACCAAGGATATGAAGAAGCTCTTGAAAACAGCCGCAGACAGG[T/A]AATGCTAACCGAATATACTGTATTCTTAGAGAAAATAATTTGTTCTGTGT
Long Flanking Sequence:
TCTTCTTTAAAAACATGGAGTAGTGCAAGTGAATTATTTTGTATGGAAAGAGTTTGATCATTTTTTCGATTAGAATTTTGATCCATAAGTTTATCTGTCACTTGGAGAAGTCTCAGAATGGCATTTTAATGTTGTTGATAAACCCTAGGCTTACTGAGGTGCGCTTTCAGTCACCTGTGATGAAATATTAGCATATCTTTCTTTTTTAATGTATAATGTGTGGTTTGTATTGTTTTGTCTGCATTTTGTACTATTGGAGCTTGTGTCTGGAATAAAGAGAATTATTTAATTCTAAAAAACATTTTTATTTTATCCATCTGAAATTTATTTAACTGTGAGGTAAACCTCACAGACAATACTGTTAACCCTTTCTTTTCATTCTGTAGATAGCAAGCGATGAACCTCCTCCTGAAGGCTGCTCTGCTTTTGTGGTTGTTCATGGTCAAAATGCCTGCAGCACCAAGGATATGAAGAAGCTCTTGAAAACAGCCGCAGACAGG[T/C]AATGCTAACCGAATATACTGTATTCTTAGAGAAAATAATTTGTTCTGTGTCAAAATCAGTTGTTTTCCTATAACATCTTTGTTGTGCTGTACGTTTTATTCAATTAATCCAGGCCAAGACCTTACCTATACAAGTCTGACCACCAATACCCAGGAGTCAATGGGACAGATGTGCCTGTAGCTATTCTTTATGCTGAAATTGGCACTAAGGAGTTCAGTACTTTTCATAAGGTTCTGTCTGAGCGAGCACAGGAGGGCAAACTTATCTATGTGCTGCGACATTTTGTGTCTGTAAGTATTAGCAGTGTAATTTCTCTATGTTCATACTGTGGGCAAATCAGATTTTTGTCATTTTCATAGTTGCAAGCGATCAAGTATAATTTATATGATCAGACATGGGTTGCTTTGGTAATTACATAGACTTATTCACATGTGTGACATCCCATTCAGATAAAGATTAAGGTTAGGATACATTAGGATTAGCTGTGCATAGAAACCTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5545
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089354 Nonsense 473 575 14 17
ENSDART00000125632 Nonsense 473 1527 14 41

The following transcripts of ENSDARG00000062089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 30476765)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29632711
GRCz11 9 29443457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCAGAGCAACATTTCCCGGTGTTATTCGACAAATACGCCGTAACTTCTA[T/A]AACCTGGTGAGTCAGCTTGTTTGTGAGTTGATTATAGTGTAAGCTCAAAT
Long Flanking Sequence:
AGATGCCCCTCGTGATTGTGAAGCACTTTGAATGCCATACACAATAAATGTGCTATATAAATACACATTACATTATATTACACCAGTTTTTCGCAAAGTGGCTGACGGGGTTTGTTCAAGTGTTTGGTCTCTCTAAACCCTTTTTTTATTTAATTTAATTTATTATTATTATTATTATTTCTTTTTACTTTGCATAGTTTTTACAAATAGATCTGTTACACACAAGAAAAATAAAATCTGAAAAAGCATAACAGGGCCATGAGCTCCTTAAATTATCTTGATTTGGTTGATTTAGAGTACATTTTTATTATGAAATAATGGAGATTCACATGTAGACTTTTGCACTTGTCTTAAAAACATGTCTTTTGTTGGTTGTCTGGTTTCTAGTGGGTTAATGATATTGAGAAGGACTCCATGTATCGTCACTGGCCCTCGAGTCTCCAGGAGCTCCTCAGAGCAACATTTCCCGGTGTTATTCGACAAATACGCCGTAACTTCTA[T/A]AACCTGGTGAGTCAGCTTGTTTGTGAGTTGATTATAGTGTAAGCTCAAATCTAGCTGCGTGTGCACAGATTAATGCAGTGATGTTTATCCCCTGATATTGCCTGTTTTTAGCACTGCAGCTGATTTGCTTTTTAAAAAAAGTGTTCAATTCTAACTTTCAGCCGTGTTTTCTGGCAGATGTTAATTAATACATTTTCACTCGCTAGCTCAATTTCCTTTCGACTTATCCCCTTTTTTATGAACGGCTGCCACAGCAGAATTCACCACCTAATAAACTTTTAATGGAAATAAATTTGGGATGTTTTTTTTTTTGTGATCATTTGAAAGGTGTTTTTCTTTGTTGTTTGCAGGTTCTGTTTCTTGACCCAGCACAGGAAGAGAGTATTGAGCTGGTGAAGTTAGCAGAGCTCTTTTACAAACACAACATTCCCCTCAGGTACAGTATATGAACTTAACAATGGAGATTAAAAGAGTTTGACTTTTTAATGATTATTTACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13827
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089354 None None 575 None 17
ENSDART00000125632 Nonsense 588 1527 17 41

The following transcripts of ENSDARG00000062089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 30478167)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29634113
GRCz11 9 29444859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATTTCCAAAAGCAAATGCTGCCAGAATTCTTGGAGTGGATTCAAGCTA[T/A]GATGACAACAGGAAGGTAATGTTRTTAGAAAGCATTATGNNNNNCATCAC
Long Flanking Sequence:
AACATTCCACAAACAAGCCTTATTTTATTATCATCATGAGCTCTTCTGTATTAACCATTTCCGTTTGTTGATTGGTGTTGAGGTTTTAATTCCGTGTCTCTTAGGATTGGGTTTGTACTGGTTGTCAATTCTGATGATGAAGTGGATGGACTTTCGGATGCTGGTGTTGCTCTCTTCAGACTGTTAAATTACATTTCAGAGGAGTATGACGAAGCTCAGGCTTTTACATCCATGGTGTCAGTGAGTATCTTTGTGTTTGCTGTTACTCTACTTTAAATCATAATTTCTCTCATAGACTGTGTTCCTAAAGCAAATGCACTGTTTTGTTGGCCCATTATATTCTAGTGAGCATGTTTATTTGTTTGTTTGTTTTTCTCCATTCAGATTTTTAATAGAATTGGGGTAGGGAAGACACTCTCTGTGGACACAATAAAAGCATATCTGAAAAAGAAATTTCCAAAAGCAAATGCTGCCAGAATTCTTGGAGTGGATTCAAGCTA[T/A]GATGACAACAGGAAGGTAATGTTATTAGAAAGCATTATGCGGTCCATCACAACAAAAAATGTCATTCATATATACTGTATATGACATTTTATTGTGAAAAGAATTATTTACAAATTTCTATACACACTTAATTTATATTATTGTTAACAATTTTAAAACTCATATTTCAAAACATTAGATGGCTGCCCTGTTTAAACTTTCTATCAATATGCATTTTCCTCAACACTTTATAAGCTAGTCCAAGCTTCCTATAACTTCCTAAGGTGGTTGAAAATCTAGTTGAATGTGTTTGAACGGCCACTAAAGACCACCTACTCTTTGCCTACTGAGTACTGTCTGACATTATAGGTAAAGTTGAAGGACATAAAATGTATAAAGTGCACAAAATGACTTTTCAATAGACATGATCCCACAGCATTTGGTGGACTTTTGAAGCTGTTAGAGCATAAACTGTATTATTTACTTTAGTTTCTTATTGGATTCACATGTTATGGCACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7187
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089354 None None 575 None 17
ENSDART00000125632 Essential Splice Site 1072 1527 28 41

The following transcripts of ENSDARG00000062089 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 30497377)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29653323
GRCz11 9 29464069
KASP Assay ID:
554-4071.1 (used for ordering genotyping assays)
KASP Sequence:
GGAGGCCGTCAGAAGCCCATATGAWCTAGATAACATCCACCTACAAGAGG[T/G]ATGAACTCTTAATSCAGCATTTATANNNNNTACAATGGTAGGTTAGCCCCTTACT
Long Flanking Sequence:
TGTTTAACTGAAAAAATGGTTTGAAAAATGGAAAAAAGGGTTTGGAACATTTTGAGGAAAACTGAGTAAATTTTGGTGAATTATCGCTTTTAAATTTGTATAGTTGTATAGTCTCCTCTTTCTTTTTAATTCTATGTAAAACATTTAGTTTAAGATAAATTTCAGGGGGGAAAAAATGAAATGGGGGAAAAAGCACTACATATTGTTTTTGTGAAGAATAAACTATCTTGATCATTTTCTTAGTGGTTCACACCTCTAGTAGGTTCGTTTTGTTAACAGTTTGTGTCTTTTTCTTTTGCTTTCTGTCAGCTTTTATCAGTATGTTTTGGAGCCGGATGTTTCCTTCTTTGGCAACAACTCCCTTTCCCCCGGCCCTATGGCTCGCTTTACTGAAATCCCAGAATCCCCTCTGCTCACTCTTAATATGATCACCCCAGAGAGCTGGATGGTGGAGGCCGTCAGAAGCCCATATGATCTAGATAACATCCACCTACAAGAGG[T/G]ATGAACTCTTAATGCAGCATTTATATACAATGGTAGGTTAGCCCCTTACTGATTTCTTCTTTTTTGCATGTTTGTCACACTTTAATATTTCAGATCATAAAATAATTTAAATAAGTAAAAGATAACACAAATAAACACATCATGCAGTTTTAAAATGAAGGTTTTATTATTAATGGAAAGCAAAATGTTAAACTTCATAGCCATGTGTAAAAAAGTCTTTGCCCCTAAAACTAAAACCTGGTTGGGCCACCCTCAGCAGCAACAAGTTTTGTCCAGCAATGTGAATGAATTTTGGCTCACTCATCTCAGATTTGTTTGATGAACTGAAACATTAAAGTTTGTGCTGGGCAAATATTTAACATGTTAATAAAGATTTGATTTGATATAAAAATGTGTGTGTATTATATATAGTCATTGTGTATATGTAATGCACGCACATACATAGAAACAAAACTAGATATTTATTTTGTTAGATAAATATTTATTTAAAGATAGATAGA
Associated Phenotype:
Not determined