Busch Lab

ZMP

zgc:153038

Ensembl ID:
ENSDARG00000062087
ZFIN ID:
ZDB-GENE-061110-43
Description:
hypothetical protein LOC777713 [Source:RefSeq peptide;Acc:NP_001071229]
Human Orthologue:
NCEH1
Human Description:
neutral cholesterol ester hydrolase 1 [Source:HGNC Symbol;Acc:29260]
Mouse Orthologue:
Nceh1
Mouse Description:
arylacetamide deacetylase-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443191]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1655
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089351 Essential Splice Site 46 408 1 5
Genomic Location (Zv9):
Chromosome 24 (position 27766238)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26816825
GRCz11 24 26895984
KASP Assay ID:
554-1595.1 (used for ordering genotyping assays)
KASP Sequence:
ATGGAAACTCATGTACACAGATGCAATGATACGATCGTCTATGCAGTTGG[T/A]AAGCCTATAAACGCTATTAGCCAATACAACTGTAACGATGAGTTAGANNN
Associated Phenotype:
Not determined