Busch Lab

ZMP

si:dkey-177f24.1

Ensembl ID:
ENSDARG00000062086
ZFIN ID:
ZDB-GENE-050419-18
Description:
Novel protein similar to human G2 protein (G2) [Source:UniProtKB/TrEMBL;Acc:Q1LV92]
Human Orthologue:
C11orf41
Human Description:
chromosome 11 open reading frame 41 [Source:HGNC Symbol;Acc:24836]
Mouse Orthologue:
D430041D05Rik
Mouse Description:
RIKEN cDNA D430041D05 gene Gene [Source:MGI Symbol;Acc:MGI:2181743]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39204 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9549 Nonsense Available for shipment Available now
sa36670 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39204
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089349 Essential Splice Site 57 961 1 16
ENSDART00000089615 None None 126 None 2
ENSDART00000132342 None None 584 None 11
Genomic Location (Zv9):
Chromosome 18 (position 27959587)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 28032439
GRCz11 18 28010679
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTTAGCAATATTCTTACTTTTATTACACAACGCGCAGGCTTCTGACGG[T/C]AAGTCGATGTTTTATTTTTATTTTTATGTTGAACCGACACTTTAAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9549
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089349 Nonsense 108 961 2 16
ENSDART00000089615 None None 126 None 2
ENSDART00000132342 None None 584 None 11
Genomic Location (Zv9):
Chromosome 18 (position 28013476)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 28086328
GRCz11 18 28064568
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCAGTAGTCCAATCAGATCCTAAAGGCTCATCAAAGAGCAGAAGGGAA[C/T]AACCTGCCTTTTCCTCTWTTCTCACACTACTTGCCAGCACAGCCCAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36670
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089349 Essential Splice Site 565 961 9 16
ENSDART00000089615 None None 126 None 2
ENSDART00000132342 Essential Splice Site 195 584 5 11
Genomic Location (Zv9):
Chromosome 18 (position 28064011)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 28136863
GRCz11 18 28115103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAGTCTTCTGTCCATGCCCATTAAAGTCCTTTTTCTCCGTGTTCTTGC[A/T]GTGATTCAGGATGTGTCAAACTCATCTCTGGAAGTGCAATACCAGAGCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4018
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089349 Essential Splice Site 673 961 11 16
ENSDART00000089615 None None 126 None 2
ENSDART00000132342 Essential Splice Site 303 584 7 11
Genomic Location (Zv9):
Chromosome 18 (position 28072388)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 28145240
GRCz11 18 28123480
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GKGCTAATGGGTAGAACTGGGATTGAGCCTAACTGTGTTTTCCACCTTGC[A/C]GCCGTGGTGAAGAATCCACCCAACAACCTGTGGATMATTGCTGCAGTGCT
Associated Phenotype:
Not determined