Busch Lab

ZMP

si:dkeyp-106g6.1

Ensembl ID:
ENSDARG00000062058
ZFIN IDs:
ZDB-GENE-030829-61, ZDB-GENE-091113-16
Human Orthologue:
SLC12A7
Human Description:
solute carrier family 12 (potassium/chloride transporters), member 7 [Source:HGNC Symbol;Acc:10915]
Mouse Orthologue:
Slc12a7
Mouse Description:
solute carrier family 12, member 7 Gene [Source:MGI Symbol;Acc:MGI:1342283]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa17478 Nonsense Available for shipment Available now
sa37961 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24565 Nonsense Available for shipment Available now
sa24564 Nonsense Available for shipment Available now
sa24563 Nonsense Available for shipment Available now
sa24562 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17478
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Nonsense 163 1119 5 26
ENSDART00000134251 Nonsense 141 1055 5 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41384282)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39923476
GRCz11 24 39811323
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTAGTAATTGTGTTTTATTGTGTTTTTGTTTTTTGTTCACAGACAATGT[T/A]GACCGCCATWTCAAKGAGTGCCATTGCCACAAACGGTGTTGTCCYAGGTA
Long Flanking Sequence:
TATAAATAAATGTGAAATAATAGTAACTATATAAATATAAACAAAGAAAAATAAACGAAAGTCATTTTTTTTATATATATATAATATTGTGTGCGCATGCGCGTGCGTGCGTGCGTGTGTGTGTGTGTGTGTGTGTGTATGCGTGTGCGTGCGTGTGCGTGTGCGCGTGTGCGTGTGTGCGCGCGCGTGTATGACTAAAATTTAAATGTAATTTTTTTATTTTATATTTAATTTACTTTTTTAAGCTAAATTTAATGTTTAATTTTAATTGTTAATTTAATTTAAAATGTGTTTTTTTGTATTTAGATTTATGTAACATTCATTTACATATTGTATATTCTCGTTTTAAACTCTAAATAATGTTAATTATTTGATTTTAATTTACATTGAAAAAATGTCATCAATATGTTTAATGTTTAGTTTTATTTTATAGCATTTTATTTCATTTTAGTTAGTAATTGTGTTTTATTGTGTTTTTGTTTTTTGTTCACAGACAATGT[T/A]GACCGCCATATCAATGAGTGCCATTGCCACAAACGGTGTTGTCCCAGGTAAGACACTTTCATATTAATTTACAACGTAAACGTGTGTGCATGTCAGAAATCTTTTCTAAACCAGTGTTTTCCACAGTGTTGTCATTGACGTTGAGTGTTTTGTTTTGCTGTGTTGACTGATGATGTGCTGGTGTTTTTGTGCAGCCGGTGGCTCGTACTACATGATCTCTCGCTCTTTGGGCCCTGAGTTTGGTGGCGCTGTGGGTTTGTGTTTCTATCTGGGCACCACATTCGCCGGTGCCATGTACATCCTCGGCACCATCGAGATCCTGCTGGTGAGAGTTCATTAATACAGCTTCATTAAGACACTGTGAAGCAGGAATATCTGTAAACGAGTGTATAATATATTAAATATTCATGACATATTCTTATTTGACTCCTAAGAATGTTCTCTTTCCTCTGTTCAGTATAAAGTTAAACACTTGACCTGACAGTAAACTGAAGTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37961
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Essential Splice Site 178 1119 5 26
ENSDART00000134251 Essential Splice Site 156 1055 5 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41384234)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39923428
GRCz11 24 39811275
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGACCGCCATATCAATGAGTGCCATTGCCACAAACGGTGTTGTCCCAG[G/A]TAAGACACTTTCATATTAATTTACAACGTAAACGTGTGTGCATGTCAGAA
Long Flanking Sequence:
AAATAAACGAAAGTCATTTTTTTTATATATATATAATATTGTGTGCGCATGCGCGTGCGTGCGTGCGTGTGTGTGTGTGTGTGTGTGTGTATGCGTGTGCGTGCGTGTGCGTGTGCGCGTGTGCGTGTGTGCGCGCGCGTGTATGACTAAAATTTAAATGTAATTTTTTTATTTTATATTTAATTTACTTTTTTAAGCTAAATTTAATGTTTAATTTTAATTGTTAATTTAATTTAAAATGTGTTTTTTTGTATTTAGATTTATGTAACATTCATTTACATATTGTATATTCTCGTTTTAAACTCTAAATAATGTTAATTATTTGATTTTAATTTACATTGAAAAAATGTCATCAATATGTTTAATGTTTAGTTTTATTTTATAGCATTTTATTTCATTTTAGTTAGTAATTGTGTTTTATTGTGTTTTTGTTTTTTGTTCACAGACAATGTTGACCGCCATATCAATGAGTGCCATTGCCACAAACGGTGTTGTCCCAG[G/A]TAAGACACTTTCATATTAATTTACAACGTAAACGTGTGTGCATGTCAGAAATCTTTTCTAAACCAGTGTTTTCCACAGTGTTGTCATTGACGTTGAGTGTTTTGTTTTGCTGTGTTGACTGATGATGTGCTGGTGTTTTTGTGCAGCCGGTGGCTCGTACTACATGATCTCTCGCTCTTTGGGCCCTGAGTTTGGTGGCGCTGTGGGTTTGTGTTTCTATCTGGGCACCACATTCGCCGGTGCCATGTACATCCTCGGCACCATCGAGATCCTGCTGGTGAGAGTTCATTAATACAGCTTCATTAAGACACTGTGAAGCAGGAATATCTGTAAACGAGTGTATAATATATTAAATATTCATGACATATTCTTATTTGACTCCTAAGAATGTTCTCTTTCCTCTGTTCAGTATAAAGTTAAACACTTGACCTGACAGTAAACTGAAGTGTGGATGTTTATTGTGTGTTGTGTGTCAGACGTACATCGTGCCGAGCGCCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24565
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Nonsense 336 1119 8 26
ENSDART00000134251 Nonsense 314 1055 8 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41381946)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39921140
GRCz11 24 39808987
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCATGAAGACAGAAATAATCGACAACGTGACGGTGACCACCAAACTCTG[G/A]TCCCTGTTCTGCTCGGGGCCGGAGCTCAATGCCAGCTGTAATGAATATTT
Long Flanking Sequence:
CCGGTTTCCCCCACAGTCCAAACACATGCAGTACAGGTGAATTGGATGGGCTAAATTGTCCGTAGTGTATGAGTGTGTGTGTGTGAATGTGTGTGTGGATGTTTCCCAGAGATGGGTTGCGGCTGAAAGGGCATCCGCTGCGTAAAAACGTGCTGGATTAGTTGGTGGTTCATTCCGCTGTGGCGACCCCAGATTAATAAAGGGACTAAGCCGAAAAGATAATGATTGAATGAATGGATATTTTAATCAGTTAAATTTCATGTTAAGTGCGCATTAATTATAATAATATTTATATGCTAATCATTTTTTTTTAGCTTTTTTGTGCTTTGGTGAATAAAAAAATCCAAACAAATGTACATAGCCTTCTCATAAATGTGAATGGTGTGTTGTGTGTCCTGCAGGGTGTGTGTGTTGGGCAACAGGACACTGCAGAACCACGACTTTGACAAGTGCATGAAGACAGAAATAATCGACAACGTGACGGTGACCACCAAACTCTG[G/A]TCCCTGTTCTGCTCGGGGCCGGAGCTCAATGCCAGCTGTAATGAATATTTCACCCTCAACAGCGTCACCGAGATCCAGGGCATCCCCGGCCTCACCAGCGGAGTCATCTCAGGTCAGAAACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACAACAGCTCAGATCAGTTTTATATAGGGTATAGGAAAATATTAATGGGGTGGGAAAAAATAATAAGCTAATCCGCTTCATTTCCAACTAGTTTTAATATTGAGTTCACACAGATATGAAGATATTTGGCTGAGTATGATGAAATGTGTTTGTCTTTGAATCATTGTAAATAAATTAATCAAATCCAAAAACTAAATCAAATAAAAAAATACAAACTATTTTATAAATAAACTGTGTCCATGGATCTGTGTGTGTGTGTTTGTGTGTGTGTCTACACGTGTGTTTGTGTGTGTTTGTTTGAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24564
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Nonsense 377 1119 9 26
ENSDART00000134251 Nonsense 355 1055 9 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41379761)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39918955
GRCz11 24 39806802
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACACATCACTAATATTGAGCTGTTGTATGGTTTGCACAGAGAACATGT[G/A]GGGAAAGTACGGTCCGGCCGGGATGCTGGTGGAGAAAGATATACCGTCTG
Long Flanking Sequence:
GCAAAACAAATGCACTGTGGACACTTTTATTTTAGCGCAGGCTTGTTTTACTGCTATAAATGCTGTCAACACATTGATCATTGCATGTTCTTGTAAGAATGTAACAGTAACAGATATTTCAGTGCAGAAATAATGCATGCGTCATCAGCACACAGATATATAAAAGCAGTATCACAATTTCTATGATGCACACATGCTGATATCGTCATCCTTTCCTGTATAATAATACTGAACCATATCATCTCTTATGAATATTAAAACACAAAACCATACAGGGTTTTTTTTGTTGTTGTTGTTGCGTGTTTTGAAGAATTCAATCTGTATTCTTCATCATGCAGTCAATTCTTGTATACTCTGAAGTTAATTTGTTTTAGTTTGTTTTATAAAGTGAACAACATGTTATCAAAGACTAATAACCATTAGATTCATTAGATTAAAGATTAATAACCATCACACATCACTAATATTGAGCTGTTGTATGGTTTGCACAGAGAACATGT[G/A]GGGAAAGTACGGTCCGGCCGGGATGCTGGTGGAGAAAGATATACCGTCTGTGTCTGCCAGTGATTCCTCGCAGGATAAATACATGCCGTATGTGGTCAATGACATCACTGCCTTCTTCACGCTGCTGGTGGGAATCTACTTCCCCTCAGTCACAGGTATGAACATCTTTACGCATCATAGGGAGGAAATAATCAACTGTGCAGCATCCCAATTCACACACTTCTACATCCTAATATTAGTGAAGCAAAGGTTCATACTTTTGAGTGTGTAACAGAAGAGCATGCAAGCTTTTGAACATACTACTTCCTCATTAATAGTATGTTGCTGAGTTGCATACCTTGTCAATAATCTCGACACATTATCCACATTTCTTTTATATTTAATTACCATATTGAAGATTCAGCAGCAACAGCAGCAGCAGGTTAATCTGCCATTCACGAGTCCTTCATGCAGAGAAATCTCCTCAGGTGTTTGGGTAAATCTGCATTCAGAGAAGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24563
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Nonsense 407 1119 9 26
ENSDART00000134251 Nonsense 385 1055 9 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41379670)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39918864
GRCz11 24 39806711
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATACCGTCTGTGTCTGCCAGTGATTCCTCGCAGGATAAATACATGCCGTA[T/A]GTGGTCAATGACATCACTGCCTTCTTCACGCTGCTGGTGGGAATCTACTT
Long Flanking Sequence:
TGTAAGAATGTAACAGTAACAGATATTTCAGTGCAGAAATAATGCATGCGTCATCAGCACACAGATATATAAAAGCAGTATCACAATTTCTATGATGCACACATGCTGATATCGTCATCCTTTCCTGTATAATAATACTGAACCATATCATCTCTTATGAATATTAAAACACAAAACCATACAGGGTTTTTTTTGTTGTTGTTGTTGCGTGTTTTGAAGAATTCAATCTGTATTCTTCATCATGCAGTCAATTCTTGTATACTCTGAAGTTAATTTGTTTTAGTTTGTTTTATAAAGTGAACAACATGTTATCAAAGACTAATAACCATTAGATTCATTAGATTAAAGATTAATAACCATCACACATCACTAATATTGAGCTGTTGTATGGTTTGCACAGAGAACATGTGGGGAAAGTACGGTCCGGCCGGGATGCTGGTGGAGAAAGATATACCGTCTGTGTCTGCCAGTGATTCCTCGCAGGATAAATACATGCCGTA[T/A]GTGGTCAATGACATCACTGCCTTCTTCACGCTGCTGGTGGGAATCTACTTCCCCTCAGTCACAGGTATGAACATCTTTACGCATCATAGGGAGGAAATAATCAACTGTGCAGCATCCCAATTCACACACTTCTACATCCTAATATTAGTGAAGCAAAGGTTCATACTTTTGAGTGTGTAACAGAAGAGCATGCAAGCTTTTGAACATACTACTTCCTCATTAATAGTATGTTGCTGAGTTGCATACCTTGTCAATAATCTCGACACATTATCCACATTTCTTTTATATTTAATTACCATATTGAAGATTCAGCAGCAACAGCAGCAGCAGGTTAATCTGCCATTCACGAGTCCTTCATGCAGAGAAATCTCCTCAGGTGTTTGGGTAAATCTGCATTCAGAGAAGTTCACATTGTTGTTGCAGATGAAATATAGCATGAATAGTGTGATTGAAATATTTTCCACTTGGCTAGATATTAACAGTCAAACAAACAAATAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4276
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Essential Splice Site 652 1119 15 26
ENSDART00000134251 Essential Splice Site 630 1055 15 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41372482)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39911676
GRCz11 24 39799523
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCCATGCTCATCGCTGGATGCATCTACAAGTACATCGAGTACCGCGGG[T/C]AAGAGCTGAAGCGCATTACACCGTGCAGACCGTAAGCTGATTACTGATCC
Long Flanking Sequence:
AGGTATAAAAAATATTAATGACCGTGTTATATGATTCAATACATATTTATAATGGCCTTATGACCATTATCGTCATGGCAGATTTAGGATGAGATTTGTTGTCTTGGTAAGGTCAAGACATGTAATGGTTGTGATGTATTTGTTTTTGCCAAGTTTTCATAAGAAACAATGTCATCTTTACATTTAAAATGTCATAACTGAGCAAATGACACTTAATAACAGTGGTCATAAGCATGCATAAAATCTCATTCACATTCATGACATTATAAAGGTTTCATGACAGTCTTATGAACACCTTTACTTAAGTTACCAAATATTTAAAACTATTTAGACATGTATTCTTGGTCTCATTTAAAGCATATTTTCTGTCATCTTCCAGGGCTCTGTCGTTCCTGGGCATGAGTTTGTGTCTGGCTCTGATGTTCATATCCTCCTGGTACTACGCTCTGGTGGCCATGCTCATCGCTGGATGCATCTACAAGTACATCGAGTACCGCGGG[T/C]AAGAGCTGAAGCGCATTACACCGTGCAGACCGTAAGCTGATTACTGATCCGGCGGCCTTTATCTGACTGAGTGATTGACTGCTGAAGCTCACTGTGTGTTCACACCCACTCTTTTCTATATGTGTGTGTTCAGGGCGGAGAAGGAATGGGGCGACGGGATCCGCGGTCTGTCCCTTAATGCTGCACGATATGCTCTCATTCGGCTGGAGGAAGCACCGCCACACACCAAAAACTGGAGGTGAGGACGATCGAAAACTCACAAATACTAAGTGCAATTATAATCAGAATGTCATTTACAAAGGAGGTGAATGCACAAAACAGGGGTCACCTATGAAATGATCTATTAAAACACAAACTTGACAGGAGAATATGCACAGCTGTAATTAAACTTTAGGTATAAACGTTGTAACAATAATATTAAATATTCACTTAATTTAAGCACTTTAAAGGGCACCTGTTATGCAAAAATCGTGTGGGAACAGTGTATGCTCCGCCCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24562
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089232 Essential Splice Site 864 1119 19 26
ENSDART00000134251 Essential Splice Site 842 1055 19 24

The following transcripts of ENSDARG00000062058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41363233)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39902427
GRCz11 24 39790274
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGGAGGAATGCTGATGCTGCTGCCCTTCCTGCTGCGCCAGCACAAGG[T/G]CAGAAAACAACACAGCAATTTAATTTAATTTAATTTTATTTTATTTTATT
Long Flanking Sequence:
ATTATATAAATATTTATGTTTTATACCCTTATTTTTTGTTTTTATTACTGTTATTAAATAATGATAAGATATAATTATGAATATATATTCATAAACTTTATTGCAGTCGATAAAATGAGTTTTTTGTGCTCTTTAATGCATCTGAAAAACTATTTTATTATATTATTAATGCATTCAAAAAATCTTAGATATTTAGATATTTTCAAGAAACAAACCTATTTCTAGGATTTTTTCCTGATCACATGCATGTATGGTGTTTACAGCTGATTTGTCTGCTCTGAAGGCATCAGGTATGTTGTTGAATGTTGTTTTGTGTGTTTTCCTTTCCTCAGAGACGGTCAGAGAGACGACAGCGGCTCATCTGGCTCTGCTGGTGGCCAAGAACGTGGACAGTTTCCCTCATCAGGAGCGTCTGACTGAAGGAACTATCGACGTGTGGTGGATCGTCCATGATGGAGGAATGCTGATGCTGCTGCCCTTCCTGCTGCGCCAGCACAAGG[T/G]CAGAAAACAACACAGCAATTTAATTTAATTTAATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTAGTTTAAATAAATTTAAGAAACTTTAGGAACTTTAAGAAGTAAACAATAACTTATTAATAAATAATAATATGAATTAATTGTTAATATAAATATTTTGTATTAATGAATATTAATTACCATTTTAATTACATTTAAATTAAATTAATAAATTAATAACAATAACTATTATAATAATTGACAATTAATTATTAATAAAAATAATAAATAAATGTCTAAAAAGTAAACAAAAGCTTACTAATAAAAATTTATATTTATTAATTAATTAATTTAATTGATTTATTTATTAATAAAAAATATCTTGCCATAAATAAATTTAACTGGCATTTACAAATACACATGTTTTTTTTATCTTCACCTTTAAGTCCCTTTAGATAAAAGTATCTGCTTAATGTTAAATGTAGAGAAACCCTGTCAGAGAAACAA
Associated Phenotype:
Not determined