Busch Lab

ZMP

si:dkey-20n3.1

Ensembl ID:
ENSDARG00000062055
ZFIN ID:
ZDB-GENE-030131-8693
Human Orthologue:
RNF38
Human Description:
ring finger protein 38 [Source:HGNC Symbol;Acc:18052]
Mouse Orthologue:
Rnf38
Mouse Description:
ring finger protein 38 Gene [Source:MGI Symbol;Acc:MGI:1920719]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa8465 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44506 Nonsense Mutation detected in F1 DNA Not yet available
sa11481 Nonsense Available for shipment Available now
sa44507 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8465
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089233 Essential Splice Site 198 673 2 13
ENSDART00000139241 Essential Splice Site 198 673 3 13
Genomic Location (Zv9):
Chromosome 1 (position 17636570)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18201738
GRCz11 1 18894675
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGTTTACCACTATCATTCAGAGCATGCGTGCGCAGATGCCACTGACAAG[G/A]TAAGACATCCTCAATGCTTATAGCCTGCAATGTAGACAAATAAACCGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44506
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089233 Nonsense 458 673 6 13
ENSDART00000139241 Nonsense 458 673 7 13
Genomic Location (Zv9):
Chromosome 1 (position 17666262)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18231430
GRCz11 1 18924367
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCGCCACACCTTCCTACTCCGGGACAGTTCTTACCCTTCCAAGCGCAA[C/T]AGTCCCGATCTGTGAGCATTATATGTTTTTGTAAAATAGCATTCAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11481
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089233 Nonsense 517 673 8 13
ENSDART00000139241 Nonsense 517 673 9 13
Genomic Location (Zv9):
Chromosome 1 (position 17668204)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18233372
GRCz11 1 18926309
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YAAACAAGTTAATGAATCTTRTGTTTTYCTGTGCGTTCTGTCCAGCCGTA[T/A]CCTCACTTCATGCCACGGCGAATCACAGGCAGACGCTACCGCTCTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44507
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089233 Essential Splice Site 550 673 8 13
ENSDART00000139241 Essential Splice Site 550 673 9 13
Genomic Location (Zv9):
Chromosome 1 (position 17668304)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18233472
GRCz11 1 18926409
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCCGTACCGCCACCTCCTTACCACCCTAGTCTGCTGCCCTACTTCCTG[T/A]GAGTTACACATACTCGCCTACACCAGAGCTTTGTGCTTAGTGATGTATTA
Associated Phenotype:
Not determined