Busch Lab

ZMP

il1rapl1a

Ensembl ID:
ENSDARG00000062045
ZFIN ID:
ZDB-GENE-061013-249
Description:
Interleukin-1 receptor accessory protein-like 1-A [Source:UniProtKB/Swiss-Prot;Acc:B6ZK76]
Human Orthologue:
IL1RAPL1
Human Description:
interleukin 1 receptor accessory protein-like 1 [Source:HGNC Symbol;Acc:5996]
Mouse Orthologue:
Il1rapl1
Mouse Description:
interleukin 1 receptor accessory protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:2687319]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa15551 Essential Splice Site Available for shipment Available now
sa21502 Nonsense Available for shipment Available now
sa34668 Nonsense Mutation detected in F1 DNA Not yet available
sa41443 Nonsense Mutation detected in F1 DNA Not yet available
sa34667 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12814 Nonsense Available for shipment Available now
sa13024 Nonsense Available for shipment Available now
sa34666 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa2524 Nonsense F2 line generated Not yet available
sa5821 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa15551
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Essential Splice Site None 701 2 13
ENSDART00000101171 Essential Splice Site None 716 2 14
ENSDART00000134157 Essential Splice Site 3 744 2 14
ENSDART00000138574 None None 550 None 10
Genomic Location (Zv9):
Chromosome 9 (position 30963931)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30119877
GRCz11 9 29930623
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTCTTAGTCCGGGCCTGACAACACGAGAYCYTCCTGAAGAATGAATGAG[G/A]TAAGTCTCTCTCTTTTTTTACACAATTGTGYTAACAAACTTGTTCATAAM
Long Flanking Sequence:
AATCCAGCTTCTGATGAACTCATTCTTTTTTTCCCCAATACATATCAGATTGGAAATACATTTATTTTTATTAGAAAAGAAATAAAAAATTAAAACTATGATAATGTGATATAAAGTCACAAGTGGCTTGTGGGTATTTGATAAGGTTTAGCTTATTTCATATGCTTTAGTACTGCTTCAGTGAACTTGAACAAGTATATTAAAAACCATTAATTTTCAATAATTTTATTAGTTTTTTTTAAATCAAAGTGTGCTTAAAATGCCTTAAAAATAAGTAAAATCTTTGTAGACTATAAATATATCTATGTATATCATTTATTTAAAAAATGCAGGCAATACATTATAGATTAATTTCATTAAAAATATTTTATTATTCTTATTTTTTTTTGCAACTTCAGGGGTGCAGCCAGGTAAGGGGCCAAACAAGACAATGTGCCCAGGGGCCTCTGAATTCTTAGTCCGGGCCTGACAACACGAGACCTTCCTGAAGAATGAATGAG[G/A]TAAGTCTCTCTCTTTTTTTACACAATTGTGCTAACAAACTTGTTCATAAACACCCTATCACACTCATAGCATTGCGATATGGCTCTATATCAACATGGCTGAGCACAATCACAGCTACTAATTGTGTTATTGCTCATTTACTCTAAGAAGGTACTGTACAAGCAGATACTATATATTTTTAAACGTATTGACCATGGGTTTGGTACTGACCATATAGTTTAACCATAGCATCTGTAGTTAAACTGAAATCATAAAGATTGCTAAACAATATGGCAACAACCCAGTTATTGCAATGTTTCTATAATAAAAAAAAAAAAACTATGTAGAACTATATGTCACATGGCAAATACAAATGCATGTATCTAATTTTTGTCACATAGGAATGAGAGCTTCCTTTTTTTGAGAGTTTCTTTTTCTTTTTTCCCCTTTGCTTACATTTTTTGTTTGGTGTTTACATCTGAAAAAAGTGTAAAAAAAAAAAAAAGTGTAGTAATGTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21502
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 39 701 5 13
ENSDART00000101171 Nonsense 39 716 5 14
ENSDART00000134157 Nonsense 67 744 5 14
ENSDART00000138574 Nonsense 39 550 2 10
ENSDART00000089206 Nonsense 39 701 5 13
ENSDART00000101171 Nonsense 39 716 5 14
ENSDART00000134157 Nonsense 67 744 5 14
ENSDART00000138574 Nonsense 39 550 2 10
Genomic Location (Zv9):
Chromosome 9 (position 30832342)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29988288
GRCz11 9 29799034
KASP Assay ID:
2260-1947.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTTTCTCTCTGCAGTGGACGGCTGCACTGATTGGTCCGTGGACTA[T/G]CTGAAGTACCGGGTGTTACACGGAGAGCCGGTGCGGATAAAGTGTGCTCT
Long Flanking Sequence:
AACTGTAAAGTTTCCTCACTCTGTACACCCCTGATGTTGTTGGCAAATGAGCATGGTTTGTAATTTTGACAATTTCAACTCGACATATGGGTGAAGCTAGTGTAAACATCCTCTGGCAGCAGTGTGGCCTATTTCCACTTAGATACTCTGTAATTAAAAAAGTCAGTTTTTATTATTTGTATGCCTTATGAAGGTCTGTTCACATCAAGAATGACAATTATAATTATTGCTATTTAACAAATGTTAGCATTCTGTATATTAAGTAGCAGTTTTGTTATCTACTGCTTCAAAGTCATGTGGATTTCAATGCGCTGGCAATATTCACAGTAGCTACATAATAACAGTACATATATAATACAACATAACAATATCCTTAATCCAGAGCTTGACTAAACAATTATCTTGTCTAGAAATCTATGTGCTTCCCCTTCTGTTAACCTTTCCTTAAACGTTTTCTTTCTCTCTGCAGTGGACGGCTGCACTGATTGGTCCGTGGACTA[T/A]CTGAAGTACCGGGTGTTACACGGAGAGCCGGTGCGGATAAAGTGTGCTCTATTTTACGGTTATATAAGAGCCAACTACACCCAGGCACAGAGCATTGGACTCAGTCTGATGTGGTACCGAAGTTCAGGATTGGGACATGGGGACTTTGAAGAGCCCATCTCCTTTGACGGGACCCGCATGAGCAAAGAGGAAGATGCCATCTGGTTCCGGCCTGCCGAGCTGCAGGACGCCGGTCTGTACTCCTGCGTTTTGAGGTGAGAAATAGAGATGTGTGCGCACATGTGTATGCGTGAACACTCATATGCTTAGATATGCAAATCCACGGGGAGAAACACACACACGCACATACACACACTCTGCCTTTCGGACATTAGCAGTATCCGAAAACATGCTTAACTTCCTGCTTTGATGTTTCCTGATTGTCTTTGAAAGCCTTCAAGAAAAGTGTCATGCTGAGAAAATTAGTGTGTGTGTATTAGTGTCTGCTCTTCTTCAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34668
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 39 701 5 13
ENSDART00000101171 Nonsense 39 716 5 14
ENSDART00000134157 Nonsense 67 744 5 14
ENSDART00000138574 Nonsense 39 550 2 10
ENSDART00000089206 Nonsense 39 701 5 13
ENSDART00000101171 Nonsense 39 716 5 14
ENSDART00000134157 Nonsense 67 744 5 14
ENSDART00000138574 Nonsense 39 550 2 10
Genomic Location (Zv9):
Chromosome 9 (position 30832342)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29988288
GRCz11 9 29799034
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTTTCTCTCTGCAGTGGACGGCTGCACTGATTGGTCCGTGGACTA[T/G]CTGAAGTACCGGGTGTTACACGGAGAGCCGGTGCGGATAAAGTGTGCTCT
Long Flanking Sequence:
AACTGTAAAGTTTCCTCACTCTGTACACCCCTGATGTTGTTGGCAAATGAGCATGGTTTGTAATTTTGACAATTTCAACTCGACATATGGGTGAAGCTAGTGTAAACATCCTCTGGCAGCAGTGTGGCCTATTTCCACTTAGATACTCTGTAATTAAAAAAGTCAGTTTTTATTATTTGTATGCCTTATGAAGGTCTGTTCACATCAAGAATGACAATTATAATTATTGCTATTTAACAAATGTTAGCATTCTGTATATTAAGTAGCAGTTTTGTTATCTACTGCTTCAAAGTCATGTGGATTTCAATGCGCTGGCAATATTCACAGTAGCTACATAATAACAGTACATATATAATACAACATAACAATATCCTTAATCCAGAGCTTGACTAAACAATTATCTTGTCTAGAAATCTATGTGCTTCCCCTTCTGTTAACCTTTCCTTAAACGTTTTCTTTCTCTCTGCAGTGGACGGCTGCACTGATTGGTCCGTGGACTA[T/G]CTGAAGTACCGGGTGTTACACGGAGAGCCGGTGCGGATAAAGTGTGCTCTATTTTACGGTTATATAAGAGCCAACTACACCCAGGCACAGAGCATTGGACTCAGTCTGATGTGGTACCGAAGTTCAGGATTGGGACATGGGGACTTTGAAGAGCCCATCTCCTTTGACGGGACCCGCATGAGCAAAGAGGAAGATGCCATCTGGTTCCGGCCTGCCGAGCTGCAGGACGCCGGTCTGTACTCCTGCGTTTTGAGGTGAGAAATAGAGATGTGTGCGCACATGTGTATGCGTGAACACTCATATGCTTAGATATGCAAATCCACGGGGAGAAACACACACACGCACATACACACACTCTGCCTTTCGGACATTAGCAGTATCCGAAAACATGCTTAACTTCCTGCTTTGATGTTTCCTGATTGTCTTTGAAAGCCTTCAAGAAAAGTGTCATGCTGAGAAAATTAGTGTGTGTGTATTAGTGTCTGCTCTTCTTCAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41443
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 167 701 6 13
ENSDART00000101171 Nonsense 167 716 6 14
ENSDART00000134157 Nonsense 195 744 6 14
ENSDART00000138574 Nonsense 167 550 3 10
Genomic Location (Zv9):
Chromosome 9 (position 30825322)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29981268
GRCz11 9 29792014
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCGCTACACTGAGAAAGGAGAGCTGGGCAAGAGTAAAGACATCTCCTG[T/A]CCCGATATCCAGGATTACGTTCAGCCTGGAGAAAAACCACAGATAACGTG
Long Flanking Sequence:
ATTTGACTTCGAAAAGCATTAGCGAACATTGCAAGTGGACCTCGGGGAAAATGTAAGTGATAAAAAATGTATGAAATGACCCTTTAAAACCTTTGAGGAAACATTTTCTATTCATTTGCTTCTCATATTCCATCAGTAAAGTGCTAATTATTTGTAGCCCTATATGAAAACTGCAGAGAAATTCAGCTCCTTTGTGGTCAAATTACACCTATCATGCTTGAATAACAAATAAAATCAGGTTTTATATTTGTGTAATTGGTTTAGTGTATAGGCTCTGCGAGATGACAGCACATTTGCGCTCAGTGATGTCTCTGGGTGAGCTCTATAGTTTATATAGGCTTACTCTGTTTGTTTGTGTGTGTGTTTTGCAGGAATTCCACGTTTTGTATGAAGGTGTCAATGACTCTGTTGGTTGCTGATAATGACACAGCTGGATGTTACAACTCAAAACTGCGCTACACTGAGAAAGGAGAGCTGGGCAAGAGTAAAGACATCTCCTG[T/A]CCCGATATCCAGGATTACGTTCAGCCTGGAGAAAAACCACAGATAACGTGGTACAAGGTATAGTGGGAGTTGCTAAGAGGTGTATTCAGTATACAGCGCACAAACCTGCGTCTTAAAGCACTTGCGATCCAGCATCTTGGCATCTGCCCCCCTGAGAATTTCAATTAAGTCATCGTAAGTCATTGTCAACGCAAACACACCTCCTTTTTATGTAAATTAGGGTTATTATACTTTATGCCTTATTCAGGGAAGTCAGCGCTATTTGCCTGGGGCAGCTAACAGTATGCTTTTACTGCACACGGAAAGCCGTAAACAGAAAATTATTTAAAACTGAGTGTTTATGTAGATATTCAATCGATCATGGGAGCAGTAATTCATCAGATGATGATCGAATTTGCGGAGGGGCAATTTAGTATACAGTTGAGTGCCTTTTCTGCATTTTAAAGAGAGGATTTAGGTGTCTGGATTGCAGTGTTGCAACAGTGACCTACAGATCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34667
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Essential Splice Site 238 701 8 13
ENSDART00000101171 Essential Splice Site 238 716 8 14
ENSDART00000134157 Essential Splice Site 266 744 8 14
ENSDART00000138574 Essential Splice Site 238 550 5 10
Genomic Location (Zv9):
Chromosome 9 (position 30797374)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29953320
GRCz11 9 29764066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAATAACGCTCTGTGTGTGTATGTGTGTGTGTGTGTGTGTTTGTTTCA[G/T]CTCCTCTGACTGAAGAGCCCCCCAGGATTCTGTTTCCCTCTGAAAACAAG
Long Flanking Sequence:
CCTCGAGTTTTAAGAGTTACATAAAGCCGAATGCAAGCACACACGTATGCAGTCACGGTGTGTGTGTGTGGTATTACCAGCTCAAATCCTGTGCTTGACAAAAGCCAAGTGAACAAACACAGTCAGCGTAATCACCAAGGAGAGAGACACGTACACACCTCTGACTCGAAGGAAATGAGCTGGAATTTAGAGCATCGTGCCCACATGGGGAGAGGAAGATCTGGAGAGAGAGAAAGAGAAAAGGAAAGAAAGAGAGAGAGAGACGGATTGAAGGATGGGGGAAAAAAGAAAAGTCAAGAAGAATAGAAACGAGAGCACTGGGGAGACCAAGACAATTCTCGCTGAGATGTTGATGGCGAGATGCTGGAGTTTACTCATCCAATCACGAACGTGTGGGCAGAGAGAGGGAGAGAGTGTGTGCTTCATCAGAAGTGCTTGATGTCACTTAGTAAAAATAACGCTCTGTGTGTGTATGTGTGTGTGTGTGTGTGTTTGTTTCA[G/T]CTCCTCTGACTGAAGAGCCCCCCAGGATTCTGTTTCCCTCTGAAAACAAGCTCCTCGCCATGGACGTGCAGCTCGGTAAGCACAGCTTCCGCTTGTGGATGTGTGTGTTTGTGTTGAGGAGGGGTGTTCGCCGTGGCATGTACTATTTTTTGAAAGAACGCAGGATATGATGTGTTTGCTGTGCAGAATATGCAAATTTCCTGAATGCATGGATTACCCAGATAACCTACTGCATTTGTTAAAATGCACAATATATAGCCAGTGCACACTGCGTGGAATATTGCATCCCATGATGCACTGCACTCGACTTGACCTTCTATTTTCCAGGGTGACAAAAATACTGGAGGTGATATCAATCATGTTTTTATTCCACGCGATTTGAATGGCTGATTCAATTTTTACAATGGGTCTGCCAAAATGAAAATGATTATGTATTTGATTCTGAAAAGCGCTGGAAAGCTCTGTGAATTAAACATTCAGGCTAATTCAAAGTGTTGTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27412
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 335 701 10 13
ENSDART00000101171 Nonsense 335 716 10 14
ENSDART00000134157 Nonsense 363 744 10 14
ENSDART00000138574 Nonsense 335 550 7 10
Genomic Location (Zv9):
Chromosome 9 (position 30764274)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29920220
GRCz11 9 29730966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCATTACTCTGACCATAGATTCACTGGAGGAGGTCGATCTGGGTAATTA[T/G]TCCTGCTATGCGGAAAACGGCAATGGGAGACGACAAGCCAACGTGCAGAT
Long Flanking Sequence:
CTAGCAGGGGTGGTCGCTGTGATGACACACTATTATTAATTCCCCTGTCTGAAAGAGAGCTGGATCAGAGCAGTGCTGAATACATCCTAATAACACAGCCAAATGTATCGCACACCATGCGCAGAATGCATTTGCATTTACATGCAGTTAAGGAGCAGCGATGTCAGCATCTTTTAAATGAAATTTCAGTTTCAAATGATTCAGCCAGGACAAACAAGTGAGCCAATGTTTTGTTATAATTAAATGAGATCCTCGTTTGTTGAGCGCCAACCCTTCCTCCCAAAAACTGTAATCTCCACAAGCTGCTCAGTCTAAAATTCATCCCCAAAATCCTCTGTCAGAAGGGGCTAATTAAAAAACTTTTATTCCACAGCCGTCGCTGAACAATGGCTCATTGTTTTTGCTCTCTCCACCAGGACCGTCAGAGAACACCTGGGTGAGCAGGAAGTGTCCATTACTCTGACCATAGATTCACTGGAGGAGGTCGATCTGGGTAATTA[T/G]TCCTGCTATGCGGAAAACGGCAATGGGAGACGACAAGCCAACGTGCAGATTGGGAAACGAGGTACACATTCAACCATAACACACATGAACTCAACCGACTGAGTCACACCAGCTGCTTCTCATTTAAAGGAACGCTACACTCGTAATGAAGCTTTGTCATTCCCTCGCTCTTGCGACGCTTCTTTGACTTTCTCTCTTTCATAAAGCACAAGATGTTTTGAAGAATGTTAAGGCTGCTCTATTTCAGGCAAATATCCCATATTTTATAACTAAATATATTTAGACCCCCCTAACACAAAAAAGTCATGCGTTCCTTATTATTATGTCAATTAAATTAGGTTTTATATCTGGTCAAAGTGGTCACAAATAGCACAGATGAAGCGATTGCATTAATATATGAGATTGCTCTTATTTTTTCGTTTGTTCGTTCGTTCATTTATTTATTTTCCTCTGACTTAGTCCCTTATTCATCAGGGGTCACCACAGCATAATGAACCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12814
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
Genomic Location (Zv9):
Chromosome 9 (position 30755444)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29911390
GRCz11 9 29722136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCGGGCTGGGTGCGATTCWCCTGCTGTTGGCGTTGTTATTGTCTGTGTA[T/A]AAATGCTACAGGATTGAGCTGCTGCTGTGCTACAGGCATCACTTCGGAGG
Long Flanking Sequence:
GCTGAAATTTCATCATTTCAGAAAAATACTTTGCATTCTGTACAGCTCCCGCTTTCAAAATTCCTTCCTTGTGTGTTTTCCAGCAGTAAAGTGCATTACATTAGATGTCTGTATTAAAATGTATTGTCAATAACATTGTAATCTTTACTTTACTTTACTTTACTTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCCCAGCATTATTGCCTTAACCACACCATTTTTCACACACTAAAGAGATGCTAAGCTAATGTTAATCAAATTCAGACAAGTCTCTCTGTGTCCATTTTGTCTCTCAGTGGAGCTGATGTACACTGTGGAGCTGGCCGGCGGGCTGGGTGCGATTCTCCTGCTGTTGGCGTTGTTATTGTCTGTGTA[T/A]AAATGCTACAGGATTGAGCTGCTGCTGTGCTACAGGCATCACTTCGGAGGAGAGGATACAGACGGAGGTAAACGCTGCACACAGGACTTGCTGAGCATAACGCTGCAAGAATTACATGTTCGTCTCTGAACATCGTTACAAGTTAGATATGTATATAACCAAAGCCTAATGCGAACATTAATTCTAAGTACAATTTGGTTATAAAATAGTGACTGTATAAATAATAGTTACATTGTAACAAGAAAAAAAGTGTAAATAATGTGTAACCCTCTTCTTCATCAGAAGCATGTAAATATACTTTAAATACACTATTAACCTGTGTCATTTCTTTCTGTCTGTCTTGTTTGTATCTTTTTTTTTCAAATTCTTGTTTTTTTATTTAGTCAATTCACGTAATCTTTCTTTTAATTAATTCTTATATGTTAATTAATTTGTTAATGCTTTAATTTGTTATTTGGTCTGCCATTTGCCATTGTTTGTTGTTGACTCTTTTAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13024
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
Genomic Location (Zv9):
Chromosome 9 (position 30755444)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29911390
GRCz11 9 29722136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCGGGCTGGGTGCGATTCWCCTGCTGTTGGCGTTGTTATTGTCTGTGTA[T/A]AAATGCTACAGGATTGAGCTGCTGCTGTGCTACAGGCATCACTTCGGAGG
Long Flanking Sequence:
GCTGAAATTTCATCATTTCAGAAAAATACTTTGCATTCTGTACAGCTCCCGCTTTCAAAATTCCTTCCTTGTGTGTTTTCCAGCAGTAAAGTGCATTACATTAGATGTCTGTATTAAAATGTATTGTCAATAACATTGTAATCTTTACTTTACTTTACTTTACTTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCCCAGCATTATTGCCTTAACCACACCATTTTTCACACACTAAAGAGATGCTAAGCTAATGTTAATCAAATTCAGACAAGTCTCTCTGTGTCCATTTTGTCTCTCAGTGGAGCTGATGTACACTGTGGAGCTGGCCGGCGGGCTGGGTGCGATTCTCCTGCTGTTGGCGTTGTTATTGTCTGTGTA[T/A]AAATGCTACAGGATTGAGCTGCTGCTGTGCTACAGGCATCACTTCGGAGGAGAGGATACAGACGGAGGTAAACGCTGCACACAGGACTTGCTGAGCATAACGCTGCAAGAATTACATGTTCGTCTCTGAACATCGTTACAAGTTAGATATGTATATAACCAAAGCCTAATGCGAACATTAATTCTAAGTACAATTTGGTTATAAAATAGTGACTGTATAAATAATAGTTACATTGTAACAAGAAAAAAAGTGTAAATAATGTGTAACCCTCTTCTTCATCAGAAGCATGTAAATATACTTTAAATACACTATTAACCTGTGTCATTTCTTTCTGTCTGTCTTGTTTGTATCTTTTTTTTTCAAATTCTTGTTTTTTTATTTAGTCAATTCACGTAATCTTTCTTTTAATTAATTCTTATATGTTAATTAATTTGTTAATGCTTTAATTTGTTATTTGGTCTGCCATTTGCCATTGTTTGTTGTTGACTCTTTTAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34666
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Essential Splice Site 404 701 11 13
ENSDART00000101171 Essential Splice Site 404 716 11 14
ENSDART00000134157 Essential Splice Site 432 744 11 14
ENSDART00000138574 Essential Splice Site 404 550 8 10
Genomic Location (Zv9):
Chromosome 9 (position 30755376)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29911322
GRCz11 9 29722068
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCTGCTGTGCTACAGGCATCACTTCGGAGGAGAGGATACAGACGGAG[G/A]TAAACGCTGCACACAGGACTTGCTGAGCATAACGCTGCAAGAATTACATG
Long Flanking Sequence:
TTGTGTGTTTTCCAGCAGTAAAGTGCATTACATTAGATGTCTGTATTAAAATGTATTGTCAATAACATTGTAATCTTTACTTTACTTTACTTTACTTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCCCAGCATTATTGCCTTAACCACACCATTTTTCACACACTAAAGAGATGCTAAGCTAATGTTAATCAAATTCAGACAAGTCTCTCTGTGTCCATTTTGTCTCTCAGTGGAGCTGATGTACACTGTGGAGCTGGCCGGCGGGCTGGGTGCGATTCTCCTGCTGTTGGCGTTGTTATTGTCTGTGTATAAATGCTACAGGATTGAGCTGCTGCTGTGCTACAGGCATCACTTCGGAGGAGAGGATACAGACGGAG[G/A]TAAACGCTGCACACAGGACTTGCTGAGCATAACGCTGCAAGAATTACATGTTCGTCTCTGAACATCGTTACAAGTTAGATATGTATATAACCAAAGCCTAATGCGAACATTAATTCTAAGTACAATTTGGTTATAAAATAGTGACTGTATAAATAATAGTTACATTGTAACAAGAAAAAAAGTGTAAATAATGTGTAACCCTCTTCTTCATCAGAAGCATGTAAATATACTTTAAATACACTATTAACCTGTGTCATTTCTTTCTGTCTGTCTTGTTTGTATCTTTTTTTTTCAAATTCTTGTTTTTTTATTTAGTCAATTCACGTAATCTTTCTTTTAATTAATTCTTATATGTTAATTAATTTGTTAATGCTTTAATTTGTTATTTGGTCTGCCATTTGCCATTGTTTGTTGTTGACTCTTTTAAAAAAATTCTTTGTTATATGTATTGTGTATTGTCTTGTTTGGTGTCTTTTGTCTTGTTTGTTGTCATTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2524
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
Genomic Location (Zv9):
Chromosome 9 (position 30751840)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29907786
GRCz11 9 29718532
KASP Assay ID:
554-3393.1 (used for ordering genotyping assays)
KASP Sequence:
GTGCCGATCTGCGAGGAGTCATTAACTACCAGGAGGTGGAAGAGTTAAAA[C/T]AATCCATTAAATGCTTRAGTGTGGTGCACTGGAACGGCCCGCAGAGCAAC
Long Flanking Sequence:
CTGAATGTTTATGTCCAGGTATGAGCAGTCAACATTACCAGGATGACACACATCTTCTTAGAGGTACAGCTTTGATTGACTGCAAAAACACGCGTGCACACATGTGCGGTGCACACAACACGCATACATTGTGCATGCAGATTGTTGTTCATGAATGACTGTGGTTGTTGTGTCTTCAGTGTGCGTTCGTCTTTAACCCTGCATCACTTTTTTCAGTTGTGAGCCCATCTGTTATTTGGTTATTCCACTTTCATTCCTTCTGCCTTTCTTTCTTTGTCTGTCGCGCAGCTTACATAGAGGACGTGTCCCGCTGCGTAGACATGAGTAAACGGCTGATCATCGTTCTGACCCCGAGCTACGTGCTGCGTCGCGGATGGAGTATATTTGAGCTGGAGTCCCGTCTGCGCAACTCTCTGGTTTCAGGGGACATTAAAGTGATCTTAATTGAGTGTGCCGATCTGCGAGGAGTCATTAACTACCAGGAGGTGGAAGAGTTAAAA[C/T]AATCCATTAAATGCTTGAGTGTGGTGCACTGGAACGGCCCGCAGAGCAACAAGCCCGGCTCTCGCTTCTGGAAGCAGCTCCGCTACACCATGCCCTACCGCCGTCCACAGCAAACCATCACCAACCATGCGCTGGACACCAGTGAACCCGGCCCCTTTGCTGACCTGCAGACCGTCTCCGCTATCTCAATGGCCACGGCTACATCCGCCGCCTTGGCACCGGCTCACCCGGAGCTGCGCCCATCCCTGCGGAGCTCATACCGCTCGCATTCGCTGGCCAGGCAGAAACACTCGCACTACCGCAGCTACGACTACGAGCTGCCCTTCACGGCCGGAGGCACACTGCCACCCCAGCACACCTACTGCAACCTGCCCCTCACTCTCCTGAACGGCCAGCGGCCCGTCAACAACAAGACCCTGCGCCAGCACAGCCTGGACGAGCACCACGGCAACAACGCCATGCTCCCGCTGCTGCCCCGAGAGACCAGCATCTCCAGCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5821
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
Genomic Location (Zv9):
Chromosome 9 (position 30751840)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29907786
GRCz11 9 29718532
KASP Assay ID:
554-3393.1 (used for ordering genotyping assays)
KASP Sequence:
GTGCCGATCTGCGAGGAGTCATTAACTACCAGGAGGTGGAAGAGTTAAAA[C/T]AATCCATTAAATGCTTRAGTGTGGTGCACTGGAACGGCCCGCAGAGCAAC
Long Flanking Sequence:
CTGAATGTTTATGTCCAGGTATGAGCAGTCAACATTACCAGGATGACACACATCTTCTTAGAGGTACAGCTTTGATTGACTGCAAAAACACGCGTGCACACATGTGCGGTGCACACAACACGCATACATTGTGCATGCAGATTGTTGTTCATGAATGACTGTGGTTGTTGTGTCTTCAGTGTGCGTTCGTCTTTAACCCTGCATCACTTTTTTCAGTTGTGAGCCCATCTGTTATTTGGTTATTCCACTTTCATTCCTTCTGCCTTTCTTTCTTTGTCTGTCGCGCAGCTTACATAGAGGACGTGTCCCGCTGCGTAGACATGAGTAAACGGCTGATCATCGTTCTGACCCCGAGCTACGTGCTGCGTCGCGGATGGAGTATATTTGAGCTGGAGTCCCGTCTGCGCAACTCTCTGGTTTCAGGGGACATTAAAGTGATCTTAATTGAGTGTGCCGATCTGCGAGGAGTCATTAACTACCAGGAGGTGGAAGAGTTAAAA[C/T]AATCCATTAAATGCTTGAGTGTGGTGCACTGGAACGGCCCGCAGAGCAACAAGCCCGGCTCTCGCTTCTGGAAGCAGCTCCGCTACACCATGCCCTACCGCCGTCCACAGCAAACCATCACCAACCATGCGCTGGACACCAGTGAACCCGGCCCCTTTGCTGACCTGCAGACCGTCTCCGCTATCTCAATGGCCACGGCTACATCCGCCGCCTTGGCACCGGCTCACCCGGAGCTGCGCCCATCCCTGCGGAGCTCATACCGCTCGCATTCGCTGGCCAGGCAGAAACACTCGCACTACCGCAGCTACGACTACGAGCTGCCCTTCACGGCCGGAGGCACACTGCCACCCCAGCACACCTACTGCAACCTGCCCCTCACTCTCCTGAACGGCCAGCGGCCCGTCAACAACAAGACCCTGCGCCAGCACAGCCTGGACGAGCACCACGGCAACAACGCCATGCTCCCGCTGCTGCCCCGAGAGACCAGCATCTCCAGCGTC
Associated Phenotype:
Not determined