Busch Lab

ZMP

NP_001099135.1

Ensembl ID:
ENSDARG00000062044
Description:
CDK5 and ABL1 enzyme substrate 1 [Source:RefSeq peptide;Acc:NP_001099135]
Human Orthologue:
CABLES1
Human Description:
Cdk5 and Abl enzyme substrate 1 [Source:HGNC Symbol;Acc:25097]
Mouse Orthologue:
Cables1
Mouse Description:
CDK5 and Abl enzyme substrate 1 Gene [Source:MGI Symbol;Acc:MGI:1927065]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa30379 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30380
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089207 Nonsense 136 525 1 10
Genomic Location (Zv9):
Chromosome Zv9_scaffold3540 (position 78959)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4462705
GRCz11 2 4303654
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCCGTTTTCAGCGGTGCCGCCGGCTACCAGAGGGAGACTCCAAACCTA[C/A]ACTCAGGGAATCCTGCCGGTGTCATACGCCCGGCAGTCCAGCCAGAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30379
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089207 Essential Splice Site 227 525 3 10
Genomic Location (Zv9):
Chromosome Zv9_scaffold3540 (position 56947)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4484717
GRCz11 2 4325666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTCCACTTCATTAAAAACATAAGACAGCATGATATGCGCAATGGAAGG[T/A]ATGCATTACATCAAACCCAACAACCCACACACAGACTCTCAGAGAACAGC
Associated Phenotype:
Not determined