Busch Lab

ZMP

si:ch211-250o15.1

Ensembl ID:
ENSDARG00000062040
ZFIN ID:
ZDB-GENE-060531-48
Description:
Novel protein similar to vertebrate ATPase, Class I, type 8B family [Source:UniProtKB/TrEMBL;Acc:A2B
Mouse Orthologue:
Atp8b5
Mouse Description:
ATPase, class I, type 8B, member 5 Gene [Source:MGI Symbol;Acc:MGI:2444287]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10847 Nonsense Available for shipment Available now
sa33561 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10847
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089173 Nonsense 77 1155 4 27
ENSDART00000139401 Nonsense 68 1228 3 25
Genomic Location (Zv9):
Chromosome 5 (position 21048551)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18761423
GRCz11 5 19265223
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTTTTGTTTGTGTGTTKTAGGTTMTTCCTGCTATTTCTTCTCTGTCTTG[G/A]TTCACCACTGTCGTCCCGCTAGTGTTAGTATTATCGGTGACTGCAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33561
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089173 Essential Splice Site 412 1155 None 27
ENSDART00000139401 None 439 1228 11 25
Genomic Location (Zv9):
Chromosome 5 (position 21060388)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18773260
GRCz11 5 19277060
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGACATTAAGAGACTATTTGAAGTTAAAAGTATGTCTTCTCTGCCCTAC[A/T]GGAGATGTTTTCCAGCACTACAGTGGACAGACGCTGGAGATCACAGAGGT
Associated Phenotype:
Not determined